ID: 1040408486

View in Genome Browser
Species Human (GRCh38)
Location 8:47132799-47132821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040408470_1040408486 21 Left 1040408470 8:47132755-47132777 CCCACCTGGGGAAATTCCACTCC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408483_1040408486 -5 Left 1040408483 8:47132781-47132803 CCGGCGGGGGGAAGCCCACACCC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408482_1040408486 -4 Left 1040408482 8:47132780-47132802 CCCGGCGGGGGGAAGCCCACACC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408481_1040408486 -1 Left 1040408481 8:47132777-47132799 CCACCCGGCGGGGGGAAGCCCAC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408471_1040408486 20 Left 1040408471 8:47132756-47132778 CCACCTGGGGAAATTCCACTCCC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408472_1040408486 17 Left 1040408472 8:47132759-47132781 CCTGGGGAAATTCCACTCCCACC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408480_1040408486 0 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408469_1040408486 26 Left 1040408469 8:47132750-47132772 CCACACCCACCTGGGGAAATTCC No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data
1040408479_1040408486 5 Left 1040408479 8:47132771-47132793 CCACTCCCACCCGGCGGGGGGAA No data
Right 1040408486 8:47132799-47132821 CACCCACCCCACGCCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040408486 Original CRISPR CACCCACCCCACGCCCACCC AGG Intergenic
No off target data available for this crispr