ID: 1040408500

View in Genome Browser
Species Human (GRCh38)
Location 8:47132825-47132847
Sequence GCCCACGCCCACCTGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040408480_1040408500 26 Left 1040408480 8:47132776-47132798 CCCACCCGGCGGGGGGAAGCCCA No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408488_1040408500 1 Left 1040408488 8:47132801-47132823 CCCACCCCACGCCCACCCAGGGA No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408483_1040408500 21 Left 1040408483 8:47132781-47132803 CCGGCGGGGGGAAGCCCACACCC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408481_1040408500 25 Left 1040408481 8:47132777-47132799 CCACCCGGCGGGGGGAAGCCCAC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408490_1040408500 -3 Left 1040408490 8:47132805-47132827 CCCCACGCCCACCCAGGGAAGCC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408484_1040408500 7 Left 1040408484 8:47132795-47132817 CCCACACCCACCCCACGCCCACC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408485_1040408500 6 Left 1040408485 8:47132796-47132818 CCACACCCACCCCACGCCCACCC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408492_1040408500 -5 Left 1040408492 8:47132807-47132829 CCACGCCCACCCAGGGAAGCCCA No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408489_1040408500 0 Left 1040408489 8:47132802-47132824 CCACCCCACGCCCACCCAGGGAA No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408493_1040408500 -10 Left 1040408493 8:47132812-47132834 CCCACCCAGGGAAGCCCACGCCC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408482_1040408500 22 Left 1040408482 8:47132780-47132802 CCCGGCGGGGGGAAGCCCACACC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data
1040408491_1040408500 -4 Left 1040408491 8:47132806-47132828 CCCACGCCCACCCAGGGAAGCCC No data
Right 1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040408500 Original CRISPR GCCCACGCCCACCTGGGGAA AGG Intergenic
No off target data available for this crispr