ID: 1040415094

View in Genome Browser
Species Human (GRCh38)
Location 8:47188722-47188744
Sequence CAGGCAGTGGCGGCTCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415094_1040415102 -7 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415102 8:47188738-47188760 CTGCCTGGAGCAGTCACCGGCGG No data
1040415094_1040415101 -10 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415101 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
1040415094_1040415106 10 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415094_1040415109 25 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415094_1040415103 -6 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415094_1040415110 26 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415110 8:47188771-47188793 TTCCAGGAGCCGCCACCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415094 Original CRISPR CAGGCAGTGGCGGCTCCCGG GGG (reversed) Intergenic
No off target data available for this crispr