ID: 1040415100

View in Genome Browser
Species Human (GRCh38)
Location 8:47188735-47188757
Sequence CCGGTGACTGCTCCAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415100_1040415109 12 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415100_1040415106 -3 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415100_1040415110 13 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415110 8:47188771-47188793 TTCCAGGAGCCGCCACCGCTGGG No data
1040415100_1040415116 29 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415116 8:47188787-47188809 CGCTGGGAGCTGCCACAGCCGGG No data
1040415100_1040415115 28 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415115 8:47188786-47188808 CCGCTGGGAGCTGCCACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415100 Original CRISPR CCGGTGACTGCTCCAGGCAG TGG (reversed) Intergenic
No off target data available for this crispr