ID: 1040415103

View in Genome Browser
Species Human (GRCh38)
Location 8:47188739-47188761
Sequence TGCCTGGAGCAGTCACCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415086_1040415103 20 Left 1040415086 8:47188696-47188718 CCCAAGCCCAGCGGACCAAGCAG No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415095_1040415103 -7 Left 1040415095 8:47188723-47188745 CCCCGGGAGCCGCCACTGCCTGG No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415098_1040415103 -9 Left 1040415098 8:47188725-47188747 CCGGGAGCCGCCACTGCCTGGAG No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415092_1040415103 5 Left 1040415092 8:47188711-47188733 CCAAGCAGCCACCCCCGGGAGCC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415097_1040415103 -8 Left 1040415097 8:47188724-47188746 CCCGGGAGCCGCCACTGCCTGGA No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415094_1040415103 -6 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415088_1040415103 14 Left 1040415088 8:47188702-47188724 CCCAGCGGACCAAGCAGCCACCC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415084_1040415103 28 Left 1040415084 8:47188688-47188710 CCCAGCAGCCCAAGCCCAGCGGA No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415087_1040415103 19 Left 1040415087 8:47188697-47188719 CCAAGCCCAGCGGACCAAGCAGC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415089_1040415103 13 Left 1040415089 8:47188703-47188725 CCAGCGGACCAAGCAGCCACCCC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415093_1040415103 -3 Left 1040415093 8:47188719-47188741 CCACCCCCGGGAGCCGCCACTGC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data
1040415085_1040415103 27 Left 1040415085 8:47188689-47188711 CCAGCAGCCCAAGCCCAGCGGAC No data
Right 1040415103 8:47188739-47188761 TGCCTGGAGCAGTCACCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415103 Original CRISPR TGCCTGGAGCAGTCACCGGC GGG Intergenic
No off target data available for this crispr