ID: 1040415104

View in Genome Browser
Species Human (GRCh38)
Location 8:47188741-47188763
Sequence CTCCCGCCGGTGACTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415104_1040415110 7 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415110 8:47188771-47188793 TTCCAGGAGCCGCCACCGCTGGG No data
1040415104_1040415109 6 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415104_1040415116 23 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415116 8:47188787-47188809 CGCTGGGAGCTGCCACAGCCGGG No data
1040415104_1040415115 22 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415115 8:47188786-47188808 CCGCTGGGAGCTGCCACAGCCGG No data
1040415104_1040415106 -9 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415104 Original CRISPR CTCCCGCCGGTGACTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr