ID: 1040415106

View in Genome Browser
Species Human (GRCh38)
Location 8:47188755-47188777
Sequence CGGCGGGAGCCTCCATTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415097_1040415106 8 Left 1040415097 8:47188724-47188746 CCCGGGAGCCGCCACTGCCTGGA No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415094_1040415106 10 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415093_1040415106 13 Left 1040415093 8:47188719-47188741 CCACCCCCGGGAGCCGCCACTGC No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415104_1040415106 -9 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415100_1040415106 -3 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415089_1040415106 29 Left 1040415089 8:47188703-47188725 CCAGCGGACCAAGCAGCCACCCC No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415098_1040415106 7 Left 1040415098 8:47188725-47188747 CCGGGAGCCGCCACTGCCTGGAG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415099_1040415106 0 Left 1040415099 8:47188732-47188754 CCGCCACTGCCTGGAGCAGTCAC No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415088_1040415106 30 Left 1040415088 8:47188702-47188724 CCCAGCGGACCAAGCAGCCACCC No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415092_1040415106 21 Left 1040415092 8:47188711-47188733 CCAAGCAGCCACCCCCGGGAGCC No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data
1040415095_1040415106 9 Left 1040415095 8:47188723-47188745 CCCCGGGAGCCGCCACTGCCTGG No data
Right 1040415106 8:47188755-47188777 CGGCGGGAGCCTCCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415106 Original CRISPR CGGCGGGAGCCTCCATTTCC AGG Intergenic
No off target data available for this crispr