ID: 1040415109

View in Genome Browser
Species Human (GRCh38)
Location 8:47188770-47188792
Sequence TTTCCAGGAGCCGCCACCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040415094_1040415109 25 Left 1040415094 8:47188722-47188744 CCCCCGGGAGCCGCCACTGCCTG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415104_1040415109 6 Left 1040415104 8:47188741-47188763 CCTGGAGCAGTCACCGGCGGGAG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415093_1040415109 28 Left 1040415093 8:47188719-47188741 CCACCCCCGGGAGCCGCCACTGC No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415099_1040415109 15 Left 1040415099 8:47188732-47188754 CCGCCACTGCCTGGAGCAGTCAC No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415100_1040415109 12 Left 1040415100 8:47188735-47188757 CCACTGCCTGGAGCAGTCACCGG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415105_1040415109 -7 Left 1040415105 8:47188754-47188776 CCGGCGGGAGCCTCCATTTCCAG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415095_1040415109 24 Left 1040415095 8:47188723-47188745 CCCCGGGAGCCGCCACTGCCTGG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415097_1040415109 23 Left 1040415097 8:47188724-47188746 CCCGGGAGCCGCCACTGCCTGGA No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data
1040415098_1040415109 22 Left 1040415098 8:47188725-47188747 CCGGGAGCCGCCACTGCCTGGAG No data
Right 1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040415109 Original CRISPR TTTCCAGGAGCCGCCACCGC TGG Intergenic
No off target data available for this crispr