ID: 1040420395

View in Genome Browser
Species Human (GRCh38)
Location 8:47234497-47234519
Sequence GACTCCTAGAATATAACATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040420393_1040420395 3 Left 1040420393 8:47234471-47234493 CCTAAGTCTAAAACTGAGAAGTA No data
Right 1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040420395 Original CRISPR GACTCCTAGAATATAACATA GGG Intergenic
No off target data available for this crispr