ID: 1040421210

View in Genome Browser
Species Human (GRCh38)
Location 8:47242110-47242132
Sequence TTTCTCTGCCTGGAATAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040421210_1040421213 -3 Left 1040421210 8:47242110-47242132 CCTATTTATTCCAGGCAGAGAAA No data
Right 1040421213 8:47242130-47242152 AAAAAAAGGCAGAAAAGCCCAGG No data
1040421210_1040421216 22 Left 1040421210 8:47242110-47242132 CCTATTTATTCCAGGCAGAGAAA No data
Right 1040421216 8:47242155-47242177 CTATGAGAAAGCAATTAAGAAGG No data
1040421210_1040421217 23 Left 1040421210 8:47242110-47242132 CCTATTTATTCCAGGCAGAGAAA No data
Right 1040421217 8:47242156-47242178 TATGAGAAAGCAATTAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040421210 Original CRISPR TTTCTCTGCCTGGAATAAAT AGG (reversed) Intergenic
No off target data available for this crispr