ID: 1040423079

View in Genome Browser
Species Human (GRCh38)
Location 8:47259219-47259241
Sequence TGCCTAGCTCCTGCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040423079_1040423087 30 Left 1040423079 8:47259219-47259241 CCCAAGGCTGCAGGAGCTAGGCA No data
Right 1040423087 8:47259272-47259294 AGACAGCATAAACCTCACTGTGG No data
1040423079_1040423083 0 Left 1040423079 8:47259219-47259241 CCCAAGGCTGCAGGAGCTAGGCA No data
Right 1040423083 8:47259242-47259264 CGTTTGACCACCGAAAGGGAAGG No data
1040423079_1040423082 -4 Left 1040423079 8:47259219-47259241 CCCAAGGCTGCAGGAGCTAGGCA No data
Right 1040423082 8:47259238-47259260 GGCACGTTTGACCACCGAAAGGG No data
1040423079_1040423081 -5 Left 1040423079 8:47259219-47259241 CCCAAGGCTGCAGGAGCTAGGCA No data
Right 1040423081 8:47259237-47259259 AGGCACGTTTGACCACCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040423079 Original CRISPR TGCCTAGCTCCTGCAGCCTT GGG (reversed) Intergenic
No off target data available for this crispr