ID: 1040423082

View in Genome Browser
Species Human (GRCh38)
Location 8:47259238-47259260
Sequence GGCACGTTTGACCACCGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040423078_1040423082 -3 Left 1040423078 8:47259218-47259240 CCCCAAGGCTGCAGGAGCTAGGC No data
Right 1040423082 8:47259238-47259260 GGCACGTTTGACCACCGAAAGGG No data
1040423080_1040423082 -5 Left 1040423080 8:47259220-47259242 CCAAGGCTGCAGGAGCTAGGCAC No data
Right 1040423082 8:47259238-47259260 GGCACGTTTGACCACCGAAAGGG No data
1040423079_1040423082 -4 Left 1040423079 8:47259219-47259241 CCCAAGGCTGCAGGAGCTAGGCA No data
Right 1040423082 8:47259238-47259260 GGCACGTTTGACCACCGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040423082 Original CRISPR GGCACGTTTGACCACCGAAA GGG Intergenic
No off target data available for this crispr