ID: 1040423434

View in Genome Browser
Species Human (GRCh38)
Location 8:47261039-47261061
Sequence GGGAAGCGGCGGGCCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040423426_1040423434 -6 Left 1040423426 8:47261022-47261044 CCGTTTCCCGCGTTGCGGGGAAG 0: 1
1: 0
2: 0
3: 7
4: 39
Right 1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG 0: 1
1: 0
2: 3
3: 50
4: 527
1040423422_1040423434 -1 Left 1040423422 8:47261017-47261039 CCGCGCCGTTTCCCGCGTTGCGG 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG 0: 1
1: 0
2: 3
3: 50
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040423434 Original CRISPR GGGAAGCGGCGGGCCGGCGC GGG Intronic
900019922 1:181252-181274 GAGGCGCGCCGGGCCGGCGCAGG + Intergenic
900092193 1:925339-925361 GGGAGGCTGCGGGGCGGCGCGGG + Intronic
900307712 1:2019240-2019262 GGGGAGCGGCGGGCGGGGCCGGG + Intergenic
900307723 1:2019267-2019289 AGGGAGCGGCGGGCTGGGGCGGG + Intergenic
900347245 1:2215606-2215628 GGCAAGCGGCTGGTCGGGGCGGG - Intergenic
901535940 1:9883103-9883125 TGGCAGCAGCGGGACGGCGCAGG + Intronic
901577359 1:10211107-10211129 GGGAAACGGAGGGCCGGTGCAGG - Intronic
902263841 1:15247319-15247341 GGGAGGCGTCGGGCCAGCTCCGG - Exonic
902323647 1:15684496-15684518 GGGAAGCGGCGGCGGGGCGGCGG + Exonic
902471176 1:16648242-16648264 TGGAACCGGAGGGCCGGGGCGGG + Intergenic
902896935 1:19485561-19485583 AGGTGGCGGCGGCCCGGCGCGGG - Intergenic
903184180 1:21620113-21620135 GGGACCCGGAGGGCCGGGGCGGG - Intronic
903622017 1:24704771-24704793 GGGAGGCGGCGGGAGGGGGCGGG - Intergenic
903643511 1:24876357-24876379 GGGGAGGGGCGGGGCGGGGCGGG + Intergenic
904008979 1:27379410-27379432 GGTAAGCGGGGGGCGGGGGCGGG - Exonic
904813787 1:33180981-33181003 GGGAAGGGGCGGGGCCGGGCTGG - Intronic
905202497 1:36323648-36323670 GGGACGGGGCGGGGCGGGGCGGG + Intronic
905847089 1:41242166-41242188 GGAGAGCGGCGGGCGGGCGGCGG + Intergenic
907274586 1:53310191-53310213 GGGAAGAGACGGGCTGGGGCAGG + Intronic
907767345 1:57424114-57424136 GGGAGGAGGCGGGTCCGCGCGGG - Intronic
907920167 1:58904177-58904199 GGGAAGGGGCTGGCCGAGGCCGG - Intergenic
908354539 1:63317479-63317501 GGGAGGCCGAGGGCGGGCGCGGG + Intergenic
908477768 1:64505861-64505883 GGGACCCGGCGGGGCGGGGCGGG - Intronic
910232003 1:84997177-84997199 AGGAGGCGGCGGGGCGGGGCGGG - Intergenic
910676444 1:89821184-89821206 GGGACGCGCCGGGGCGGCGAAGG - Exonic
910835166 1:91501163-91501185 GGGAATCCGCCGGCCAGCGCTGG - Exonic
911188772 1:94927465-94927487 GGTCAGCGGCGGGCCAGCCCCGG - Intergenic
912174658 1:107141154-107141176 GGGGAGTGGCGGGCCGGCGCTGG + Intronic
912619516 1:111140556-111140578 GGGTGGCGGAGCGCCGGCGCGGG + Intronic
912813864 1:112813606-112813628 GGGAAGCGGGGGGCAGGGGCGGG - Intergenic
914667318 1:149842088-149842110 GGGACGGGGCGGGGCGGGGCGGG - Intergenic
914668449 1:149851702-149851724 GGGACGGGGCGGGGCGGGGCGGG + Intronic
915319977 1:155051252-155051274 GGGAGGGGGCGGGCCGGGGCGGG + Intronic
916414097 1:164576639-164576661 GGGGAGCCTCGGGCCGCCGCCGG - Intronic
917141645 1:171841501-171841523 GCCAAGCGGCGGGCTGGCGGCGG + Exonic
918015937 1:180632414-180632436 GGGAGGCGGCCGGCCGCGGCGGG - Intronic
920385763 1:205569347-205569369 GGGAAGGGTCGGCCCGGCGAGGG - Intronic
920648194 1:207818333-207818355 GGGACGGGGCGGGACGGGGCGGG + Intergenic
921207022 1:212858094-212858116 GGAAAGCGGCCGGCGAGCGCTGG - Intergenic
921432800 1:215083021-215083043 CGGCGGCGGCGGGCAGGCGCGGG + Intronic
922234359 1:223712337-223712359 GGGATGGCGCGGCCCGGCGCCGG - Exonic
922472880 1:225887702-225887724 GGGACGCGGGGGGGCGGTGCGGG - Intronic
922811092 1:228416223-228416245 GGGAGTCGGAGGGCTGGCGCCGG - Intronic
924382133 1:243474729-243474751 GGGACGCGGCGTGGCAGCGCAGG + Intronic
924946038 1:248847644-248847666 GGGCAGCGGCGGGGCCGCTCTGG - Exonic
924957677 1:248944959-248944981 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
924957682 1:248944988-248945010 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1062889645 10:1048792-1048814 GGGGAGCTGCGGGACGGGGCGGG - Intronic
1062952752 10:1516976-1516998 GGGAAGGGACTGGCCGGCGTGGG - Intronic
1063115366 10:3068300-3068322 GGGACGCGGCGGGGGTGCGCGGG + Intronic
1064011848 10:11742281-11742303 GGGGAGCGGCGAGCCGGGGGCGG + Intergenic
1064011876 10:11742337-11742359 GGGGAGGGGCGTGCCGGGGCGGG + Intergenic
1064028852 10:11870113-11870135 GGGAAGCCGTTGGCCAGCGCCGG - Exonic
1064086340 10:12349171-12349193 CGGAAGCGCCGGGCGGGCGGGGG - Intergenic
1064274226 10:13891861-13891883 GGCGAGGGGCGGGCCGGCGGCGG - Intronic
1065844243 10:29731972-29731994 TGGAAGCGACGGCCCAGCGCAGG + Intronic
1065844679 10:29735431-29735453 GGGGAGGAGCGGGCCGGGGCAGG - Intronic
1066022952 10:31320169-31320191 GGGGCGCGGCGGGGCGGCGCGGG + Intronic
1067060786 10:43077012-43077034 GGGTAGGGGCGGGGCGGGGCGGG - Exonic
1068731466 10:60363066-60363088 GGGTTGCGGCGGGCGGGCGGGGG + Intronic
1070079115 10:73168231-73168253 GGGAGGGGCCGGGCCGGAGCCGG + Exonic
1070152163 10:73811632-73811654 GGGAGGCGGCGCGCCGCCGCTGG + Exonic
1070390651 10:75967759-75967781 GGGAGGCGGCGGGCAGGGGTGGG + Intronic
1070877384 10:79826372-79826394 AGGAAGCGGCGGGGCGGCGGCGG + Intergenic
1071643879 10:87342416-87342438 AGGAAGCGGCGGGGCGGAGGCGG + Intergenic
1072656807 10:97335114-97335136 GGGGAGGGGCGGGCCGCCGCGGG + Intergenic
1072784078 10:98268414-98268436 GGGGAGCGGGGGGGCGGCGGGGG + Intergenic
1073520220 10:104121686-104121708 TGGAGGCGGCGGGCTGGCGGGGG + Intergenic
1076371677 10:129959586-129959608 GGGAAGCCGCGGGAAGCCGCGGG - Intronic
1076382881 10:130037232-130037254 CGGAAGCGGCGGCCCGGCCTTGG - Intergenic
1076720156 10:132388924-132388946 GGGAAGCAGCTGCCCGGCCCTGG + Intergenic
1076722210 10:132397572-132397594 GGGCCGGGGCGGGCCGGGGCGGG + Intronic
1076864525 10:133160342-133160364 CGGCAGCGGCGGGCGGGCGGGGG + Intergenic
1076880520 10:133237305-133237327 GGGGAGCGGCGCGCGGGGGCGGG - Intergenic
1076909219 10:133379100-133379122 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909229 10:133379120-133379142 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909239 10:133379140-133379162 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076909265 10:133379190-133379212 GGGGAGGGGCGGGGAGGCGCGGG - Intergenic
1076916338 10:133424535-133424557 GGGAAGGAGCGGGCGGGCGGCGG + Exonic
1076936445 10:133569330-133569352 GGGAAGGAGCGGGCGGGCGGCGG + Intronic
1076977889 11:189421-189443 GAGACGCGGCGCGCCGGCGCAGG + Intronic
1077048053 11:554929-554951 GGGAGGGCGCGGGCGGGCGCCGG - Exonic
1077360770 11:2139334-2139356 CGGAAGGGGGGGGCCGGGGCCGG + Intronic
1080802144 11:35618802-35618824 GGGAAGCGAGGCGCGGGCGCGGG - Exonic
1081938163 11:46918646-46918668 GGAAGGGGCCGGGCCGGCGCTGG - Intergenic
1083342549 11:61967872-61967894 GGGAAGCTGCGAGGAGGCGCAGG + Intergenic
1083560859 11:63671789-63671811 GGGAAGGGGCGGGCTGGCTCGGG + Intronic
1083579087 11:63813535-63813557 GGCGAGCGGCGGGCGGGCGGCGG + Exonic
1083667893 11:64285406-64285428 GGCGAGGGGCGGGCCCGCGCGGG + Intronic
1083686641 11:64380488-64380510 GGGGAGCCGCGGGCAGGCACGGG + Intergenic
1083799984 11:65041186-65041208 GGGGAGCGGCGGGTCGGGGCGGG - Exonic
1083889679 11:65589625-65589647 GGGCAGGGGCGGGCAGGAGCTGG + Intronic
1084151330 11:67289258-67289280 GGGCTGCGCCGGGCCGGGGCGGG - Intronic
1084212328 11:67629958-67629980 GGGAAGAGGCGGGGCGAGGCGGG + Intergenic
1084516813 11:69642030-69642052 GGGGAGCGGCCGCCGGGCGCTGG + Intronic
1084522910 11:69675353-69675375 CGGAAGCGGCGGCGCGGGGCAGG + Intronic
1085318099 11:75558142-75558164 GGGTAGGGGCGGGCCTGCTCTGG + Intergenic
1087014614 11:93543213-93543235 GCGAGCCGGCGGGCGGGCGCGGG - Intronic
1087634440 11:100687133-100687155 GCGAAGGGGCGGGGTGGCGCTGG + Intergenic
1088823479 11:113475284-113475306 GGGCCGCGGCGGGGCGGGGCGGG + Exonic
1089543610 11:119206126-119206148 GGGAAGCGGCCGGCCGCGGCCGG - Exonic
1090636947 11:128695132-128695154 GGGAATGGCCGGGCGGGCGCGGG - Intronic
1090768258 11:129895608-129895630 CGGAAGGGGCGGGGCAGCGCGGG + Intergenic
1091286706 11:134412120-134412142 GGGGAGCGGGGAGCGGGCGCGGG + Intergenic
1091616077 12:2052547-2052569 GGGGGGCTGCAGGCCGGCGCGGG + Intronic
1091759412 12:3077295-3077317 GGGGAGGGGCGGGGCGGAGCGGG - Intergenic
1092487361 12:8914440-8914462 GGGAGGCGGAGGGACGGCGGGGG + Intronic
1092810403 12:12266972-12266994 GGGAAGCGGGGCGCCGGGGGAGG - Intronic
1093435292 12:19129598-19129620 GGGATGCGGAGGGGCGGCGACGG + Intergenic
1096154860 12:49336286-49336308 AGGGAGAGGTGGGCCGGCGCGGG - Exonic
1096178769 12:49539386-49539408 GGGATGGGGCGGGCAGCCGCGGG + Exonic
1096609216 12:52789992-52790014 GGGGAGCGGAGGGGAGGCGCTGG + Exonic
1097981511 12:65741634-65741656 GGGCAGGGGCGGGGCGGGGCCGG + Intergenic
1100619415 12:96256822-96256844 AGGAGGCAGCGGGCCGGGGCAGG + Intronic
1101135442 12:101739105-101739127 GGGACGCGGCGGGGCCGGGCAGG - Intronic
1101865182 12:108515298-108515320 GGGAGCCGGCGGCCCGGAGCTGG + Exonic
1102007497 12:109597804-109597826 GGAAAGGTGGGGGCCGGCGCAGG + Exonic
1102015591 12:109645914-109645936 GGGATGCAGCAGGCAGGCGCGGG - Intergenic
1102025712 12:109713554-109713576 GGCATGCTGCGCGCCGGCGCCGG - Intergenic
1102084350 12:110124188-110124210 GGGACGGGGCGGGACGGGGCGGG - Intergenic
1102240167 12:111320256-111320278 GGGCAGCGGGGGCCCCGCGCAGG + Exonic
1102289281 12:111685794-111685816 GGGCAGGCGCTGGCCGGCGCGGG + Exonic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103513936 12:121494541-121494563 GGGAAGCGGCCGCCCGCTGCAGG + Intronic
1103612483 12:122132409-122132431 GGGAAGGGGCTGGCAGGCACAGG + Intronic
1103649687 12:122422783-122422805 AAGAGGCGGCGGGGCGGCGCGGG - Intergenic
1103800315 12:123533620-123533642 GGGCAGCGGGCGGCGGGCGCGGG + Exonic
1103905374 12:124324976-124324998 GGGAGGCGGAGGGAGGGCGCGGG + Exonic
1103915648 12:124374364-124374386 GGGTAGGGCCGGGCCGGGGCGGG - Intronic
1103918765 12:124388908-124388930 GGGACGCGGCGGGCGGAGGCTGG + Intronic
1104014654 12:124953850-124953872 GTGCAGCGGCGTGCCGGCACGGG + Intronic
1105014406 12:132777399-132777421 GGGAAGGGGCGGCCCGGCGCGGG - Intronic
1106157637 13:27172183-27172205 GGGGTGCGGCGGGGAGGCGCGGG + Intergenic
1106422437 13:29595315-29595337 GGGCCGCGGCAGGGCGGCGCGGG - Intronic
1107946037 13:45418422-45418444 CGGACGGGGCGGGGCGGCGCGGG - Intronic
1108373366 13:49792359-49792381 GAGGGGCGGGGGGCCGGCGCCGG - Intronic
1108668123 13:52652747-52652769 GGGAGGCGACACGCCGGCGCGGG - Intronic
1110630248 13:77698390-77698412 GGGCGGTGGCGGGCCGGAGCCGG + Intronic
1112505197 13:99970999-99971021 GGGGAGCAGCGGTCCGGCACCGG - Exonic
1113768331 13:112894301-112894323 GAGAAGGGGCGGGGCGGGGCGGG - Intergenic
1113863106 13:113502927-113502949 GGGGAGCGGCTGGCCGGCAGAGG + Intronic
1113989951 13:114353294-114353316 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989956 13:114353323-114353345 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989961 13:114353352-114353374 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1113989966 13:114353381-114353403 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1115119969 14:29927534-29927556 GGGCAGCGGAGGGCGGGGGCTGG + Exonic
1115320754 14:32077151-32077173 GGGGAGGGACGGGCCGCCGCTGG + Intronic
1115752920 14:36508375-36508397 GGGCAGGGGCGGGGCGGGGCGGG + Intronic
1116820365 14:49621188-49621210 CGGAAGGGGCGGGCGGGCGGCGG - Exonic
1116828287 14:49693167-49693189 GGCAAGCGGCGGGCCAGCGACGG + Exonic
1116945281 14:50830717-50830739 GGGCGGGGGCGGGCCGGCGGGGG - Intronic
1116945437 14:50831153-50831175 AGGAAGGGCCGGGCCCGCGCGGG + Intergenic
1117913864 14:60657324-60657346 GTGGAGCGGAGAGCCGGCGCAGG + Intronic
1120993383 14:90397630-90397652 GGGGAGGGGCGGGCCGGGGGGGG - Intronic
1121850688 14:97219020-97219042 GGGCAGCGCGGGGCCAGCGCTGG + Intergenic
1122130831 14:99603990-99604012 GGGAAGCGCCGGCCGGGCGAGGG - Exonic
1122230950 14:100306173-100306195 AGGAGGCGGCGGGCCGGGCCGGG - Intronic
1122286267 14:100654683-100654705 TGGAAGGGGAGGGCGGGCGCTGG + Intergenic
1122399633 14:101459001-101459023 GGGGAGTGGGGCGCCGGCGCTGG - Intergenic
1122904541 14:104795744-104795766 GGGAGAGGGCGGGCCGGCGGCGG - Intronic
1202855044 14_GL000225v1_random:44555-44577 GGGCACGGGCGGGCCGGCGACGG - Intergenic
1123500733 15:20878503-20878525 GGCACGCGGCGTCCCGGCGCTGG + Intergenic
1123557979 15:21452196-21452218 GGCACGCGGCGTCCCGGCGCTGG + Intergenic
1123594207 15:21889477-21889499 GGCACGCGGCGTCCCGGCGCTGG + Intergenic
1123684329 15:22786611-22786633 GGGGCGCGGCGCGCAGGCGCAGG + Exonic
1124712995 15:32030609-32030631 GGGAGGCGTCTGGCTGGCGCTGG + Exonic
1124722321 15:32120957-32120979 GGGAAGGGGCGGGGTGGCGGCGG - Intronic
1125328938 15:38564289-38564311 GGAAGTCGGCGGGCGGGCGCCGG + Intronic
1126053895 15:44711761-44711783 GGGAAGCGGCGGGGTGGCCTGGG + Intronic
1126109419 15:45166958-45166980 CGGAAGCCGCGCGCCGGCGGAGG - Intergenic
1127867467 15:63043679-63043701 GGGCAGCGGCGGGCGGGCGCGGG - Intronic
1127931648 15:63600994-63601016 GGGCCGCGGCGGGCGCGCGCGGG - Intronic
1128067698 15:64775103-64775125 GGGCAGCGGCGGGAAGGCGCCGG + Intronic
1128482741 15:68054229-68054251 GTGGAGGGGCGGGCCGGGGCGGG + Exonic
1129052806 15:72796898-72796920 GGGAAGAGGCGGGCGGGCGGGGG - Intergenic
1129162162 15:73752978-73753000 GGCGAGCGGCGGGCCGGGCCGGG + Intergenic
1129503119 15:76059497-76059519 GGGAAGCGGAGGACCCCCGCGGG - Intronic
1129780221 15:78264890-78264912 GAGAAGGTGCGGGGCGGCGCGGG + Exonic
1130531028 15:84748286-84748308 GGGACGCGACGGGACGGGGCGGG - Intergenic
1130908476 15:88255797-88255819 GGGCAGCGGCGAGCTGGGGCGGG + Intronic
1131060285 15:89400148-89400170 GGGGCGCGGCGGGGCGGGGCGGG - Intergenic
1131119790 15:89814963-89814985 GGGAAGCCGCGGGCGGACGGGGG - Intronic
1131272604 15:90956358-90956380 GGGAAGCTGCGGGACGGGGTGGG + Intronic
1131367618 15:91853572-91853594 TGGCAGCGGCGGGCGGCCGCGGG + Intergenic
1131827373 15:96332041-96332063 GGGCGGCGGCGGGGCGGCGGCGG - Exonic
1132065527 15:98727810-98727832 GGGAAACCGCCGGCCGGCCCTGG + Intronic
1132342248 15:101086141-101086163 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1132342265 15:101086203-101086225 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1132342282 15:101086265-101086287 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1132342299 15:101086327-101086349 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1132342316 15:101086389-101086411 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1132342334 15:101086451-101086473 GGGAAGAGCCGCGCAGGCGCCGG - Intergenic
1202966330 15_KI270727v1_random:179368-179390 GGCACGCGGCGTCCCGGCGCTGG + Intergenic
1132453634 16:10599-10621 GGGGCGCGCCGCGCCGGCGCAGG + Intergenic
1132480845 16:165442-165464 GAGACGCCGCGGGCCGGCCCGGG - Intronic
1132552852 16:560495-560517 GGGAAACTGAGGCCCGGCGCCGG - Exonic
1132644025 16:990674-990696 GGGAAGGCGGGGGCCGGGGCAGG - Intergenic
1132663763 16:1072724-1072746 GGGAGGGGGCGGGGCGGGGCGGG - Intergenic
1132683665 16:1153567-1153589 GGGAGGGGGCGGGCGGGGGCGGG + Intronic
1132804930 16:1771037-1771059 GGGAAGCGGGCGGGCGGCTCCGG - Intronic
1133333069 16:4988120-4988142 GGGAAGGGGCGGGGAGGCGGAGG - Intronic
1134275343 16:12770888-12770910 GGGGAGGGGCGGGGCGGGGCTGG + Intronic
1136261811 16:29082341-29082363 GGGCCGCGGCGGGCCGGGGTCGG + Intergenic
1136458526 16:30395709-30395731 GGGCAGCGGCAGGGCGCCGCGGG + Intronic
1136498872 16:30659804-30659826 CGGAAGCGGCCTGCCGGCTCGGG + Exonic
1136544718 16:30948673-30948695 GGGAAGAGGCAGCCCGGCGAGGG + Exonic
1137671964 16:50284311-50284333 GGGCAACGGCAGGCAGGCGCAGG - Intronic
1138348647 16:56334961-56334983 GGGAACCTGCGGGCTGGGGCAGG + Intronic
1138590611 16:57997714-57997736 GGGAAGCGACGGGGCGGCTGTGG + Exonic
1139459442 16:67110065-67110087 GGGCTGTGGCGGGCCGGCGGGGG + Exonic
1139489597 16:67279303-67279325 GGGGTGCGGCGGGGCGGGGCTGG + Exonic
1139678192 16:68539614-68539636 GGGGAGCGGCAGGCCCGGGCTGG + Intronic
1139954693 16:70687416-70687438 GGGAAGGAGCAGGCCGGCTCGGG + Intergenic
1140442638 16:74999303-74999325 GGCGAGCGGCGGGCGGGCGCGGG - Exonic
1141665535 16:85463423-85463445 GGGAAGTGGCCGGCGGGCACCGG + Intergenic
1142211910 16:88812389-88812411 CGGAGGCGGCGGGCCTGGGCTGG + Intergenic
1142465311 17:133886-133908 GAGACGCGGCGCGCCGGCGCAGG + Intergenic
1142573746 17:892622-892644 GGGAAGGGGCGGGGCGGGGTGGG + Intronic
1142623809 17:1180130-1180152 GGGCAGCGGGGCTCCGGCGCTGG + Intronic
1143321190 17:6070333-6070355 GGACAGCGGCCGGCCGCCGCCGG - Intronic
1143446901 17:7015012-7015034 GGGACGGGGAGGGCGGGCGCCGG + Intronic
1143595102 17:7909343-7909365 GGGCCGCGGCGGCCCCGCGCGGG + Intronic
1143731953 17:8886444-8886466 GGGAAGAGGCGGTTCGGGGCAGG + Intronic
1143904687 17:10198906-10198928 GCGAGGGGGCGGGCCGGGGCGGG + Intergenic
1144581391 17:16461439-16461461 GGGAAGGGGAGGGCCGGCTGGGG - Intronic
1144967823 17:19089087-19089109 TGGAGGGAGCGGGCCGGCGCTGG + Intergenic
1144980094 17:19162976-19162998 TGGAGGGAGCGGGCCGGCGCTGG - Intergenic
1144988128 17:19215256-19215278 TGGAGGGAGCGGGCCGGCGCTGG + Intergenic
1146057750 17:29589583-29589605 GAGCGGCGGCGGGGCGGCGCGGG - Intronic
1146194042 17:30795863-30795885 GGGAAGCGGCAGGCGGGGGAGGG + Intronic
1146657286 17:34642106-34642128 GGGAAGCGTGGGGCTGGGGCTGG - Intergenic
1147150461 17:38510930-38510952 GGGAGGCGGCCGAGCGGCGCGGG - Exonic
1147332925 17:39709526-39709548 GGGCAGTGGCGGGCAGGCACTGG - Intronic
1147333009 17:39709908-39709930 GGGAAGGGGAGGGCTGGGGCCGG + Intronic
1147392906 17:40121564-40121586 GGGAAGGGGCCGCCCGGCGCAGG + Intergenic
1148262052 17:46192943-46192965 GGAGAGCGGCGGGCCCGGGCCGG - Intronic
1148356576 17:46979313-46979335 GGGGACCGGCGGGGCGGGGCCGG - Intronic
1148564864 17:48626743-48626765 GGGAAGCGGCGGGCTGCCTTGGG + Intronic
1148617674 17:49013416-49013438 GGGAGGAGGCGGGACGGGGCGGG - Intronic
1148622239 17:49043489-49043511 GGGAGGCGGCGGGACTGCGCTGG - Exonic
1151740553 17:75979207-75979229 AAGAAGGGGCGGGCCGGGGCGGG - Exonic
1151854395 17:76710765-76710787 GCGCAGGGGCGGGACGGCGCCGG + Exonic
1151856684 17:76726792-76726814 GGGGAGGGGCGGGGCGGGGCGGG - Intronic
1151980018 17:77503155-77503177 GAGAAGCGGCGGGGTGGCACGGG - Intergenic
1152085255 17:78214174-78214196 GAGTAGAGGCGGGGCGGCGCGGG - Exonic
1152227177 17:79097865-79097887 GGGAAAGGGGGGCCCGGCGCGGG - Intronic
1152354104 17:79798301-79798323 GGGAAGCTGGGGGACGTCGCCGG + Intronic
1152362470 17:79839096-79839118 GGGAGGCTGCGGGCCGGGCCGGG - Intronic
1152463859 17:80455043-80455065 GGAGGGCGGCGGGCCGGGGCGGG - Intergenic
1152608889 17:81306112-81306134 GGGGAGAGGAGGGCCGGCCCTGG + Intergenic
1152627407 17:81393893-81393915 GGGAAGCGGGCGGCCGGCCCCGG - Intergenic
1152648558 17:81481577-81481599 TGGCTGCGGCGGGCCGGCCCGGG + Intergenic
1152703899 17:81833188-81833210 GGGACGGGGCGGGGCGGGGCGGG - Intronic
1152711218 17:81871242-81871264 CGGAGGCGGCGGGTCGGGGCGGG - Intronic
1152758920 17:82098351-82098373 GGGACCCGGCGCGCCGCCGCCGG + Intergenic
1152801723 17:82333793-82333815 AGGAGGCGGCGGACCCGCGCGGG + Exonic
1153805296 18:8705277-8705299 GGGCAGCAGCGGGCCGGCGGTGG + Intergenic
1154246270 18:12702557-12702579 GAGAAGCGGCGGGGAGACGCCGG - Exonic
1155026967 18:21949832-21949854 GGGAGGCGGTGGGGCGGGGCTGG - Intergenic
1155693101 18:28651457-28651479 TGGAGGCGACGGGCCGACGCTGG - Intergenic
1157095093 18:44680170-44680192 GGGAAGCGCGGGGCCGGCCGGGG + Intronic
1157279321 18:46335248-46335270 ACAAAGCAGCGGGCCGGCGCGGG + Intronic
1157586226 18:48803074-48803096 GGGAGGCGGGGGGATGGCGCTGG - Intronic
1159511248 18:69400826-69400848 GGGAGGGGGCGGGCCGGGGGGGG - Intergenic
1160163324 18:76491547-76491569 GGGGGGCGGGGGGCGGGCGCCGG + Intronic
1160164075 18:76495151-76495173 GGGAGGCGGCGGGCCTGGGGAGG + Exonic
1160164159 18:76495428-76495450 GGGAAGCCTCCGGCCTGCGCCGG - Intergenic
1160857457 19:1223944-1223966 GGGAAGTGGTGGGCAGGGGCCGG + Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160897012 19:1407837-1407859 GGGGAGCGGCGGGCCGGGCTCGG - Intronic
1160948097 19:1652624-1652646 GGGGCGGGGCGGGGCGGCGCGGG - Intergenic
1160984786 19:1833576-1833598 GGGAAACGGCCGGCTGGGGCTGG + Intronic
1161029161 19:2050102-2050124 GGGAAGGGGAGGGCAGGTGCTGG - Intronic
1161333713 19:3700097-3700119 GGGAAGCGGGAGGCCTGCGAGGG - Intronic
1161333842 19:3700478-3700500 AGGGCGCGCCGGGCCGGCGCGGG + Exonic
1161733903 19:5978635-5978657 GGGAAGTGGCGAGAGGGCGCGGG + Intergenic
1161959548 19:7516194-7516216 GGGGAGCCGGCGGCCGGCGCGGG + Exonic
1162022412 19:7873934-7873956 GGGAGGCGGTGGGCTGGGGCGGG - Intronic
1162036621 19:7943585-7943607 GGTGAGCGGCGGTGCGGCGCTGG - Exonic
1162799421 19:13102757-13102779 GGGAGAAGGCGGGCCGGCCCGGG - Exonic
1162914197 19:13865498-13865520 GGGGCGCGGCGGGGCGGGGCGGG + Intronic
1162954604 19:14091037-14091059 GGAAAGCGGCGGGCGGGGGAGGG + Intergenic
1162964975 19:14151320-14151342 AGGAAGAGGCGGGCGGGCCCGGG - Exonic
1163551190 19:17967192-17967214 GGGCAGCAGCGAGCGGGCGCGGG - Intronic
1163667884 19:18611661-18611683 GGGGAGGGGCGGGGCGGGGCGGG + Intronic
1164639249 19:29812333-29812355 GGGAGGCGACGGGCCGGTGAGGG + Intronic
1164713422 19:30375237-30375259 TGGCAGCCGCGGGCCGGCGGGGG - Intronic
1165172366 19:33903172-33903194 GGGAAGGGGCGGGGCGGGGAGGG + Intergenic
1165172375 19:33903187-33903209 GGGGAGGGGCGGGGCGGGGCGGG + Intergenic
1165172443 19:33903592-33903614 GGGAAGCTGAGGGCCGGGGGAGG - Intergenic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165327501 19:35122858-35122880 GGGAGCAGGCGGGCCGGGGCTGG + Intronic
1165922464 19:39307615-39307637 TGTGAGCGGCGGGCGGGCGCCGG - Exonic
1166064390 19:40348571-40348593 GGGGAGCGCCGGGCCGACGGTGG - Intronic
1166094532 19:40530687-40530709 AGGGAGGGGCGGGGCGGCGCGGG + Intronic
1166303097 19:41923010-41923032 GGGAAGAGGCGGGAGGGGGCTGG + Intronic
1166369261 19:42292240-42292262 GGGAAGGGGTGGGGCGGGGCCGG + Intronic
1166568468 19:43779300-43779322 TGGGAGCGGCGGGCAGGCCCCGG + Intronic
1166858028 19:45792816-45792838 CGGAAGCCGCTGGCCCGCGCCGG + Intergenic
1166984193 19:46649734-46649756 GCGGAGCGGCGGGCCCGCGCCGG - Exonic
1167074341 19:47239786-47239808 GGGCAGCGGCGGGCGGGGCCTGG - Intergenic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167589902 19:50398858-50398880 GGCAAGCGGCGGCCAGGCCCAGG + Exonic
1167593758 19:50417289-50417311 GGGAAGGGGCGGGGCAGCCCAGG - Intronic
1168078487 19:53992921-53992943 GGGGGGCCGCGGGCCGGCGGCGG + Exonic
1168154048 19:54463447-54463469 AAGAAGCGGCAGGCCGGCGGGGG + Exonic
1168239906 19:55083779-55083801 GTGATGGGGCGGGCCGGGGCTGG + Intronic
1168344314 19:55642939-55642961 GGTGTGCGGCGGCCCGGCGCGGG - Exonic
1168641476 19:58034308-58034330 GGGAGGGGGCGGGCCGGGCCGGG + Intronic
1168728656 19:58606927-58606949 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728664 19:58606957-58606979 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728687 19:58607047-58607069 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728695 19:58607077-58607099 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728706 19:58607111-58607133 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728714 19:58607142-58607164 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728729 19:58607180-58607202 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728737 19:58607211-58607233 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1202647095 1_KI270706v1_random:152778-152800 GGGAGGAGCCGGGCCGGGGCAGG - Intergenic
1202703571 1_KI270713v1_random:5037-5059 TGGAACCGGAGGGCCGGGGCGGG + Intergenic
925927631 2:8681773-8681795 GGGGAGCGGCGGGCGGGGGGCGG - Intronic
926901309 2:17754109-17754131 CGGAAGAGGCGGGGCCGCGCGGG + Intronic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
927606484 2:24491190-24491212 GGGAACGGGCGGGGCGGGGCGGG + Intergenic
927843209 2:26458011-26458033 GGGGAGCGGCTGGCGGGAGCTGG + Exonic
927881436 2:26692644-26692666 GGGGGGCGGGGGGCGGGCGCGGG + Intergenic
929133589 2:38602477-38602499 GGGAAGCGACGCCCCGGGGCGGG - Exonic
931355821 2:61537432-61537454 GGGAGGCGGCGGGCGGGCCGGGG - Intronic
931671766 2:64654000-64654022 GGGGAGAGGCGGGCCGGGGCGGG - Intronic
932252694 2:70258319-70258341 GCGCAGCGGCCGCCCGGCGCGGG - Intronic
932556046 2:72825745-72825767 GGGAACGGGCGGGACGGGGCAGG - Intronic
933666892 2:84971356-84971378 GGGAGTCGGCCGGCCGGCGCGGG + Exonic
934688091 2:96335999-96336021 GGGGAGGGGAGGGCCGGCGCGGG + Intronic
934754585 2:96816421-96816443 GGTACGCGGAGGGGCGGCGCGGG + Exonic
936103549 2:109604380-109604402 GGGAAGGGGAGGGGCGGGGCGGG + Intronic
937018943 2:118633091-118633113 GGGCAGGGGCGGGGCGGGGCGGG - Intergenic
938018392 2:127885984-127886006 AGGAAGCGGCGGGGCGGCGGCGG + Intergenic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
940453738 2:153871874-153871896 GGGAGGCGGCGGGCTGGGGTGGG + Intergenic
941104903 2:161341145-161341167 GCGCAGGGGCGGGACGGCGCCGG + Intronic
941666143 2:168246484-168246506 GGGAAGCATCGGCCCGGTGCAGG + Intronic
944221869 2:197310962-197310984 GGCAGGCGGCGGCCCGGTGCGGG - Intronic
944831265 2:203535530-203535552 GGAGGGCGGAGGGCCGGCGCGGG - Intergenic
945189013 2:207166892-207166914 CGCAAGCGGGGGGCGGGCGCAGG - Intronic
946370636 2:219279472-219279494 GGGCAGGGGCGGGGCGCCGCAGG + Exonic
947549724 2:231037636-231037658 TGGAAGCGGCGGGGGGCCGCGGG + Exonic
948368952 2:237475361-237475383 CGGAAGGGCCGGGGCGGCGCGGG + Intergenic
948393394 2:237627764-237627786 GGGGGGCGCCGGGCGGGCGCGGG + Intronic
948492338 2:238321141-238321163 TGTAAGCGGCGGCCCGGAGCCGG - Intronic
948611253 2:239168641-239168663 GAGCAGTGGCGGGCCGGCGCGGG - Intronic
948645181 2:239400329-239400351 GGGCGGGGGCGGGCGGGCGCCGG - Intronic
948805997 2:240453614-240453636 GGGCTGCGGCGGGCAGGCGAGGG - Intronic
948817543 2:240520335-240520357 GAGCCGCGGCGGGCGGGCGCCGG - Intronic
1169065598 20:2692879-2692901 CGGCCGCGGCGGGGCGGCGCGGG + Exonic
1169483542 20:6006566-6006588 AGGCGGCGGCGGGCCGGCCCTGG + Intronic
1170150077 20:13220130-13220152 GGGAAGGGCTGGGCCGGCGCTGG + Intergenic
1171215716 20:23350822-23350844 GGGAAGCCGCGGAACTGCGCCGG + Exonic
1171223193 20:23420468-23420490 GGGAGGGGGCGGTCCGGCGAGGG - Intronic
1172178503 20:32986787-32986809 GGGACGCGGCGGGCAGTGGCTGG - Intronic
1172756590 20:37289662-37289684 GGGGAGCGGCGCGGCGGCGCGGG + Intronic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1174258694 20:49277936-49277958 AGGCAGTGGCGGGTCGGCGCGGG + Intronic
1174494896 20:50931941-50931963 GAGAAGCGGCGGGAAGGCGCCGG + Intergenic
1175340940 20:58228610-58228632 GGGATGCGGCGGGCGGCGGCGGG - Exonic
1175465039 20:59185115-59185137 GGGAAGCTGGGGGCCGGGGCTGG - Intergenic
1175927040 20:62476048-62476070 GGGAAGGGGCGGCGCGGCGGGGG - Intergenic
1175962136 20:62642564-62642586 GGGGAGCGGGGAGCTGGCGCGGG + Intronic
1175967325 20:62666102-62666124 GGGGAGCGGGGGGGCGGGGCGGG - Intronic
1175992507 20:62796711-62796733 GGCAACCGGCGGGGCGGGGCGGG + Intronic
1176080778 20:63272292-63272314 GGGGACCGGGGGACCGGCGCGGG - Intronic
1176178614 20:63739722-63739744 GGGACGGGGCGGGGCGGGGCGGG + Intronic
1176373730 21:6077228-6077250 AGGAAGCGGCCGGGCAGCGCTGG - Intergenic
1176380721 21:6111068-6111090 GGGCCGGGGCGGGCCGGGGCGGG + Intergenic
1178485795 21:33019666-33019688 GGAAAGAGGCGGGCGGGCGCGGG + Intergenic
1179444315 21:41420667-41420689 GGGAATCGGAAGGCCGGCCCTGG - Exonic
1179742751 21:43427172-43427194 GGGCCGGGGCGGGCCGGGGCGGG - Intergenic
1179749747 21:43461015-43461037 AGGAAGCGGCCGGGCAGCGCTGG + Intergenic
1179810125 21:43865038-43865060 GGGACGCGGGGGGACGGCGCGGG - Intergenic
1179833290 21:44011985-44012007 GGGGAGCAGCGGCCCGCCGCGGG + Intergenic
1180156641 21:45981576-45981598 GGGGAGGGGCGGGGCGGGGCGGG - Intergenic
1180258383 21:46649756-46649778 GGGCAGCTGGGGGCCGGAGCTGG + Intronic
1180264139 21:46698846-46698868 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264144 21:46698875-46698897 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264149 21:46698904-46698926 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264154 21:46698933-46698955 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264164 21:46698991-46699013 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264169 21:46699020-46699042 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264174 21:46699049-46699071 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264179 21:46699078-46699100 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264184 21:46699107-46699129 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264189 21:46699136-46699158 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264194 21:46699165-46699187 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264199 21:46699194-46699216 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264204 21:46699223-46699245 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180264209 21:46699252-46699274 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
1180699690 22:17774513-17774535 GGGCCGGGGCGGGCCGGGGCGGG - Intronic
1181023938 22:20117154-20117176 GCGAAGCGAGCGGCCGGCGCGGG - Exonic
1181466717 22:23114383-23114405 GGGAAGGGTGGGGCCGGGGCCGG - Intronic
1181956373 22:26590193-26590215 GGGATGGGGCGGGGCGGGGCGGG - Intronic
1182355250 22:29719919-29719941 GGGAAGGGGCGGGCTGGGGGTGG + Intergenic
1182578737 22:31291227-31291249 AGGCAGCGGAGGCCCGGCGCGGG + Exonic
1183216278 22:36482124-36482146 TGGAAGAGGCGGGCGGGCCCTGG + Intergenic
1183479757 22:38057106-38057128 GGCAACCGCCGGGCCGGCGCGGG + Intronic
1183577363 22:38700641-38700663 GGTCAGCGGCGAGCGGGCGCGGG + Exonic
1184465863 22:44668683-44668705 GGGACGCGGCGGAGCGGGGCGGG + Intronic
1184779667 22:46640813-46640835 GGGGGGCGGGGGGCCGGGGCAGG - Intronic
1185430377 22:50807227-50807249 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
950438448 3:12994059-12994081 GGTAGGAGGCGGGCCGGCGGGGG - Intronic
950610660 3:14124779-14124801 GGGAGGGGGCGGGTCCGCGCGGG - Exonic
953454892 3:43033296-43033318 TGGAAGCGGCGGGCCACAGCAGG - Exonic
953526233 3:43691616-43691638 GGGAAGCGGCGGGAGGGCGGGGG + Intronic
953656880 3:44861545-44861567 TGGACTCGGTGGGCCGGCGCGGG + Intronic
953705157 3:45225541-45225563 GGGCGGCGGCGGGCCGGAGGCGG + Exonic
954186193 3:48918887-48918909 CGGAGGCGGCGGGCCGACGCCGG - Exonic
956761227 3:72446962-72446984 GGGGAGCCGCGGGCCGGATCTGG + Intergenic
960556326 3:119034690-119034712 GGGGAACAGCGGCCCGGCGCTGG - Exonic
961469131 3:127100584-127100606 GGGATGGGGCGGGCCTGCGGAGG - Intergenic
961827521 3:129606717-129606739 GGGAGGCGGGGGGCGGGCCCGGG + Exonic
962309180 3:134313408-134313430 GGGTAGGGGCGGGCAGGGGCGGG + Intergenic
963335751 3:143972147-143972169 GGGAAGGCGCGGGCCTGAGCGGG - Exonic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
964201222 3:154121380-154121402 GCGTGGGGGCGGGCCGGCGCCGG + Intronic
964720409 3:159763936-159763958 GGGAAGGGGCGGGGCGGGGCGGG + Intronic
966860682 3:184229750-184229772 GGGATGCCGCGGGCTGGCTCTGG - Intronic
967423962 3:189304868-189304890 GGGAGGAGGCGGGCGGGCGATGG - Intronic
967685277 3:192409904-192409926 GGGAGGCGGCGGCGCGGCGGCGG - Intronic
967858218 3:194134168-194134190 AGGAGGCGGCCGGCCGGCCCAGG + Intergenic
967904199 3:194487081-194487103 GGGAAGGGGCGGGGAGGGGCGGG + Intronic
968186964 3:196639639-196639661 GGGAAGCGCGGCGCGGGCGCGGG - Intergenic
968452379 4:681612-681634 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452388 4:681632-681654 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452397 4:681652-681674 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452406 4:681672-681694 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452415 4:681692-681714 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452424 4:681712-681734 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968452433 4:681732-681754 TGGAGGGGGCGGGGCGGCGCTGG - Intronic
968471916 4:786354-786376 GGGAGGCGGCGGGCGCGGGCAGG + Exonic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968701323 4:2059463-2059485 GGGACGCGGCCGGGCGGCGGCGG - Intergenic
968976024 4:3822414-3822436 GGCAGGCTGCGGGCCGGTGCGGG - Intergenic
969353916 4:6614111-6614133 GGGAAGTGGCTGGCAGGGGCAGG + Intronic
972245549 4:37243380-37243402 GGGAAGGGGTGGGCGGGCACAGG - Intergenic
972245906 4:37245065-37245087 GCGATGTGGCCGGCCGGCGCGGG + Exonic
974016761 4:56655674-56655696 GGGAAGCGGGGAGGCGGCGGCGG + Intronic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
977941974 4:102868990-102869012 CGGAAGCGGCCGGCGGGCACTGG - Exonic
978795710 4:112705895-112705917 GGGCCGCGGCGGGCCGGGGTCGG - Intergenic
980496629 4:133592855-133592877 GGGAACCGGAGTGCCGGTGCTGG - Intergenic
981528798 4:145733173-145733195 GGGAAGAGGCGGACCGGGGAGGG - Intronic
983904409 4:173169143-173169165 GCGAGGGGGCGGGCCGGCGGCGG - Intronic
985068506 4:186145226-186145248 GGGAAGCGTCAGGCCGGCCCCGG + Intronic
985236795 4:187883989-187884011 GGTAAGCGGAGGCCCGGCACAGG + Intergenic
985466744 4:190203771-190203793 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985466749 4:190203800-190203822 GAGGCGCGGCGCGCCGGCGCAGG - Intergenic
985790991 5:1926666-1926688 GGGAAGCAGCGGGCAGGTGCTGG - Intergenic
986608613 5:9546157-9546179 GGGCAGGGGCGGGGCGGGGCGGG - Intergenic
988437501 5:31193622-31193644 GGGAGGGGGCGGGCGGGGGCAGG + Intergenic
990557599 5:56951736-56951758 GGGAAGAGGCGCGGAGGCGCCGG + Intronic
990825498 5:59893589-59893611 GGGCAGCAGCGCGCCGGCCCGGG - Exonic
994043352 5:95283762-95283784 GGGGAGCGGGGGGCGGGGGCCGG - Intronic
998331837 5:141334475-141334497 GGGGAGGGGCGGGGCGGGGCGGG + Intronic
998374589 5:141682281-141682303 GGGAACCGGCCGGGCGGGGCGGG - Intergenic
999235208 5:150086438-150086460 GGGAAGTGGCAGGCAGGTGCAGG + Exonic
1000220417 5:159209175-159209197 GGGAAGCGGCCGGGGGGCGCGGG + Intronic
1001545824 5:172570065-172570087 GGGACGGGGCGGGGCGGGGCGGG - Intergenic
1002006537 5:176238775-176238797 GGAGCGCGGCGGGCCGGGGCAGG + Intronic
1002029406 5:176416674-176416696 GGGAAGCGCCGCGCCGGTCCCGG - Intergenic
1002046225 5:176543171-176543193 GGGCGGCCGCGGGCCGGCGGAGG - Intronic
1002047314 5:176549375-176549397 CGGAGGCGGCAGGCAGGCGCCGG - Intronic
1002219841 5:177671861-177671883 GGAGCGCGGCGGGCCGGGGCAGG - Intergenic
1002277515 5:178113607-178113629 GGGAAAACGCGGGCGGGCGCCGG - Exonic
1002350178 5:178577602-178577624 AGGCAGCGGGGGGCAGGCGCGGG - Intronic
1002895816 6:1379531-1379553 GGGAGGCGGCGGGACAGCGGAGG - Intergenic
1002927832 6:1615004-1615026 TGGAGGCTGCGGGCCGGCGCGGG - Intergenic
1003272918 6:4623233-4623255 GGGAAGCGGCAGGGGGGCGGGGG + Intergenic
1004286839 6:14329157-14329179 GGGAAGCTGCGGGGTGGCTCAGG + Intergenic
1006177526 6:32131330-32131352 GGGAGGGGGCGGGGCGGCGGGGG + Intergenic
1006335403 6:33417928-33417950 CGGAAGGGGCGGGGCGGGGCCGG + Intronic
1007111205 6:39314326-39314348 GAGAGGCGGGGAGCCGGCGCCGG + Exonic
1007451315 6:41941782-41941804 GGGAAGCGGCGCGCGCGCGCGGG - Exonic
1007781423 6:44257035-44257057 GGGAGGGGGTGCGCCGGCGCTGG + Intronic
1010213469 6:73381653-73381675 GGAAAGAGGTGGGCCGGCGTGGG + Intronic
1013117744 6:107115375-107115397 GGGGAGGGGCGGGCCGGGGGTGG - Intergenic
1014035731 6:116765332-116765354 GGGCAGCGAGGGGCCGGCCCGGG - Intronic
1014724878 6:124962331-124962353 GAGGAGCGGCGGGCCGGGCCAGG + Intergenic
1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG + Intergenic
1015315026 6:131807954-131807976 GGGGAGGGGCGGGGCGGGGCGGG + Intergenic
1015965516 6:138692853-138692875 GGGCAGCGGCGGGGCGCCGAGGG + Intergenic
1016400739 6:143677858-143677880 GGGAAGCGGGGGGAGGGCGCAGG - Intronic
1016923300 6:149317307-149317329 GGGAGGACGCGGGCCGCCGCTGG - Intronic
1019200006 6:170306598-170306620 CGGACGCGGCGCGCAGGCGCCGG - Intronic
1019318736 7:405258-405280 GGGAAGGGGCAGGCGGGCTCTGG + Intergenic
1019562254 7:1664894-1664916 GGGAAGGGGCGGGTGGGAGCGGG + Intergenic
1019622683 7:2000315-2000337 GGGAAGTGGCAGGCCGGGGTGGG - Intronic
1020016422 7:4834540-4834562 GGGAAGAGGGGGCCCGGAGCTGG - Intronic
1020252910 7:6483851-6483873 GGGGTGTGTCGGGCCGGCGCAGG + Intronic
1020281699 7:6653310-6653332 AGGAAGCGCCGTTCCGGCGCGGG - Exonic
1021450337 7:20778272-20778294 GGGGAGCGGCGGGCCCGGGCCGG + Intergenic
1021719247 7:23490434-23490456 GGGCGGGGGCGGGCGGGCGCGGG + Intergenic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1022104667 7:27189332-27189354 GGGAGGCAGCGGGAGGGCGCCGG + Intergenic
1022350787 7:29564884-29564906 GGGAGGCGGCGGGGCGGCCTCGG - Intronic
1022728107 7:32998765-32998787 AGGAAGCTGCAGGCCGGCGGTGG + Intronic
1023788182 7:43729265-43729287 GGGAGGCCGCGACCCGGCGCCGG + Intronic
1023812901 7:43926341-43926363 GGGAAGCAGCGGGGCTGCCCGGG - Intronic
1025045548 7:55689254-55689276 AGGAAGCTGCAGGCCGGCGGTGG - Intergenic
1026732670 7:72925199-72925221 GGGCTGCGGCGGGCCGGCCAGGG + Intronic
1026822217 7:73557387-73557409 GGGAGCCGACCGGCCGGCGCTGG - Intronic
1027111394 7:75442620-75442642 GGGCTGCGGCGGGCCGGCCGGGG - Intronic
1028417578 7:90596342-90596364 GGGCGGCGGCGGCGCGGCGCGGG + Intronic
1029374978 7:100171839-100171861 GGGAAGAGGCGGGCCGGCTGTGG - Exonic
1029494479 7:100889728-100889750 GGGGAGGGGCGGGGCGGGGCGGG - Intergenic
1032130618 7:129224897-129224919 GGGACGGGGCGGGGCGGGGCTGG + Intergenic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1033033266 7:137846957-137846979 TGGAGGGTGCGGGCCGGCGCGGG - Intronic
1033253279 7:139778036-139778058 GGGGGGCGGCGGGCGGGGGCGGG + Intronic
1034469794 7:151249001-151249023 GGGAGGCGGCGGGGGGTCGCCGG + Intronic
1035160585 7:156947569-156947591 GGGAAGCGGCGGGAAGCGGCGGG + Intergenic
1035286405 7:157809997-157810019 GGGAACCGCCAGGCCGGAGCTGG + Intronic
1035356856 7:158280905-158280927 GTGTAGCCGTGGGCCGGCGCAGG - Intronic
1035450484 7:158974158-158974180 GGAACGCGGAGGGCGGGCGCTGG - Intergenic
1035512938 8:206280-206302 GAGGCGCGGCGCGCCGGCGCAGG + Intergenic
1035600623 8:894888-894910 GGGTAGCGGCCGGCAGGGGCGGG + Intergenic
1036631971 8:10522218-10522240 GGGATGGGGCGGGCCGGGGGTGG - Intergenic
1036643920 8:10600693-10600715 GGGAGGCGGAGGGCAGGCTCTGG - Intergenic
1037481925 8:19313632-19313654 TGGGCGCGGCGGGGCGGCGCGGG + Exonic
1038204927 8:25457805-25457827 GGGAGGAGGCGCGCCGGCTCCGG - Intronic
1038303979 8:26383013-26383035 GGGCAGGGGAGGGACGGCGCAGG + Exonic
1038304190 8:26383714-26383736 GGGCAGCGTCTGGCGGGCGCGGG + Intronic
1039554780 8:38468053-38468075 CGGGGGCGGCGGGCCGGAGCCGG - Intronic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1041045391 8:53882034-53882056 GGGAAGCGGCGCTCCGGGACCGG + Intronic
1041304648 8:56446783-56446805 GGGGAGCGGCGCGCGGGTGCTGG - Intergenic
1044734933 8:95269287-95269309 GGGAAGCGGTGCGCATGCGCGGG - Intergenic
1047287949 8:123504503-123504525 GGGAAGAGGCGGAAAGGCGCTGG + Intronic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1049195324 8:141312668-141312690 GGGAAGCTGAGGGCAGGGGCTGG - Intergenic
1049344623 8:142131879-142131901 GGGAAGGTGGGGGCCGGCCCGGG - Intergenic
1049419565 8:142510810-142510832 GCGGGGCGGCGGGCCGGGGCCGG + Intronic
1049598290 8:143494610-143494632 GGGAAGCGGCAGGTCGGGGGAGG + Intronic
1049732512 8:144185790-144185812 GGGAGGGGGAGGGGCGGCGCAGG + Intronic
1049756586 8:144313699-144313721 GGGAGGCGGGGCGGCGGCGCGGG - Intronic
1049879774 8:145053627-145053649 GGGAAGCAGCGGGGAGGCCCTGG + Intronic
1050304985 9:4298238-4298260 GGGGACCGGGGGGCCGGCGTGGG - Intronic
1051235366 9:14993362-14993384 TGGAAGCGCAGGCCCGGCGCGGG + Intergenic
1051278983 9:15422769-15422791 GGCGAGCGGCGAGGCGGCGCGGG - Exonic
1053181260 9:35972276-35972298 GGGGAGCGGCGGGCGGCTGCTGG + Intergenic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057489585 9:95510916-95510938 CGGATGCGCCGGGCCGGCTCCGG + Intronic
1057489893 9:95512377-95512399 GGGAAGCGGCGGGTGGGGGGTGG - Intronic
1057705262 9:97391186-97391208 GTGAAGGCCCGGGCCGGCGCAGG - Intergenic
1057752423 9:97803551-97803573 GGGACGGGGCGGGGCGGCGGGGG - Intergenic
1058912567 9:109534290-109534312 GGCAAGCGGCGGGCGGCTGCTGG + Intergenic
1060810862 9:126610902-126610924 GGGAAGCGGTGGAGAGGCGCGGG + Intergenic
1060979237 9:127783222-127783244 GGGAAGTGGCGGGCGGATGCTGG + Intergenic
1061248543 9:129413816-129413838 GGGGAGGGGCCGGGCGGCGCGGG - Intergenic
1061450606 9:130665122-130665144 GGGAAGGGAGGGGCCGGCGGGGG - Intronic
1061488722 9:130933710-130933732 GGGAAGCGGCGGGCGGGTGGGGG + Intronic
1061559502 9:131393877-131393899 GGGGAGCGGCGGGAGGGGGCTGG - Intergenic
1061986120 9:134131308-134131330 GGGAAGAGGGGGGCCGTCCCCGG + Intergenic
1062230651 9:135479938-135479960 GGGAGGCGGCGGGCCGGGGGCGG - Exonic
1062544318 9:137054749-137054771 GGGAAGGGGAGGGACGGCCCAGG + Intergenic
1062548981 9:137077393-137077415 GGGATGGGGCGGGGCGGGGCGGG + Intergenic
1062556213 9:137114414-137114436 GGGGGGCGGCGGGACGGCGGGGG + Intronic
1062598068 9:137307938-137307960 GAGAACCGGCGGGCGGGGGCGGG + Intronic
1062696119 9:137877388-137877410 GGGACGGGGCGGGCCGGCCCAGG + Intergenic
1185461514 X:334782-334804 GGGAAGAGGCGCGCCCGCCCAGG - Intronic
1185469412 X:373709-373731 GGGCAGGGCCGGGCCGGGGCCGG + Intronic
1185736524 X:2500561-2500583 GGGAAGGGTCGGGCCGGGTCGGG + Intronic
1188005502 X:25013567-25013589 GGGGAACGGCCGGACGGCGCAGG - Exonic
1189137094 X:38561455-38561477 GGGGCGGGGCGGGGCGGCGCGGG - Exonic
1189137098 X:38561465-38561487 GGGAAGAGGCGGGGCGGGGCGGG - Exonic
1189321564 X:40090449-40090471 GGGGAGGGGCGGGGCGGGGCGGG + Intronic
1190598423 X:52067763-52067785 GGGAAGAGGCTGGCCAGCACAGG - Intronic
1190610401 X:52186310-52186332 GGGAAGAGGCTGGCCAGCACAGG + Intronic
1197753251 X:129979914-129979936 GGGAAGTGGGGGGCCGGGGGAGG + Intergenic
1198533336 X:137565815-137565837 GGCAAACGGCGGGACGCCGCCGG - Intergenic
1199699081 X:150363372-150363394 GGCCGGCGGCGGGCGGGCGCGGG + Intronic
1199798668 X:151227905-151227927 AAGAAGCGGCGGGCCCGAGCTGG - Intergenic
1199971449 X:152864803-152864825 GGGAAGAGGAGGGCCAGCTCTGG + Intronic
1199976534 X:152897898-152897920 GAGAAGGGGCGGGCGGGCGGAGG + Intergenic
1200084910 X:153599236-153599258 GAGGAGCGGCGGGGCGGCGAGGG - Intronic