ID: 1040424390

View in Genome Browser
Species Human (GRCh38)
Location 8:47270528-47270550
Sequence GACCAAGGAGGTTTGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040424390_1040424399 12 Left 1040424390 8:47270528-47270550 CCCGCCCCCAAACCTCCTTGGTC 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1040424399 8:47270563-47270585 CAATTTTGTTGATCTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040424390 Original CRISPR GACCAAGGAGGTTTGGGGGC GGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900367276 1:2316333-2316355 AGCCAAGGAGGCTGGGGGGCTGG + Intergenic
900373121 1:2341084-2341106 GACCGAGGTGGTGTGGGGACCGG - Intronic
900487513 1:2930472-2930494 GACCCAGGAGCTAGGGGGGCCGG + Intergenic
900615309 1:3563044-3563066 GACCAAGAAGGGGTGTGGGCAGG - Intronic
900711217 1:4115672-4115694 TAACAGGGAGCTTTGGGGGCAGG - Intergenic
901227451 1:7622081-7622103 GACCCTGGAGGTATGGGGGGAGG + Intronic
902736885 1:18407182-18407204 GAACAAGGAGGTTCTGTGGCCGG + Intergenic
903538439 1:24082552-24082574 GCCCAGGGAGGTTTGCAGGCTGG + Intronic
904162647 1:28532709-28532731 GGGCAAGGAGGTGTGGAGGCAGG + Intronic
904452860 1:30627493-30627515 GACCATGGAGGGTGAGGGGCTGG + Intergenic
904594011 1:31631816-31631838 GACTAAGGAGGTCTGTGGGCAGG - Intronic
905732447 1:40306090-40306112 GAGCAAGGAAGTCTGGGGCCAGG - Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906694752 1:47816428-47816450 AAGCAAGGAGGTTAGGGAGCAGG - Intronic
907073581 1:51559117-51559139 GACCAAGGAGGGATGGGGAGGGG + Intergenic
911031576 1:93494465-93494487 TTCCCAGGAGGTTTGGGGGTGGG + Intronic
911559210 1:99383452-99383474 GACCACTGGGGTTAGGGGGCTGG - Intergenic
915040814 1:152967008-152967030 GACAGTGGAGGTTTGGGGCCAGG - Intergenic
916019221 1:160777871-160777893 GACCCAGGAGGATTTGGGGGAGG + Intergenic
916722387 1:167494163-167494185 GACGATGGAGGGTTGGGGGATGG + Intronic
919791019 1:201291067-201291089 AACCAAGGAGTACTGGGGGCAGG - Intronic
920385387 1:205567874-205567896 GACTGAGGAGGTATGTGGGCGGG - Intergenic
920879791 1:209869225-209869247 GAACAAGAAGATTTGGGGGATGG + Intergenic
921162849 1:212485339-212485361 GACCAAGGAGGCCGGGAGGCAGG - Intergenic
923083227 1:230680344-230680366 GACCAGGAAAGTTTGGAGGCAGG - Intronic
923571845 1:235123189-235123211 GACTAAAGAGGTCTGAGGGCCGG + Intronic
1067245536 10:44538982-44539004 GACCAAGGAGGAATAGGAGCAGG - Intergenic
1067558471 10:47288224-47288246 ACACAGGGAGGTTTGGGGGCAGG - Intergenic
1067737944 10:48873413-48873435 ACCCCAGGAGGTTTGGGGCCAGG + Intronic
1068519755 10:58065163-58065185 CACCCAGGAGGTTGGGGGTCAGG - Intergenic
1070150366 10:73801465-73801487 GACCAAGGAGCTGTGGCAGCGGG + Exonic
1070332578 10:75429012-75429034 GACCAAGGAAGATTGGAAGCCGG - Intergenic
1070538790 10:77401112-77401134 GAACAAGGAGATTTTGAGGCAGG - Intronic
1070820288 10:79350341-79350363 GACCCAGGTGGTGTTGGGGCTGG + Intronic
1072005557 10:91243189-91243211 GACTAAGGAGGTTGTGGGGAGGG + Intronic
1072564081 10:96602948-96602970 GACCAAAGAGCTTTTGGGCCTGG + Intronic
1073315562 10:102578280-102578302 GAACAAAGAGGCTTGGGGCCAGG + Intronic
1073392676 10:103192732-103192754 GACCGAGGAGCTCTGGGGGCGGG + Intronic
1073579882 10:104655770-104655792 GAGCAAGGCGGAGTGGGGGCAGG - Intronic
1074413675 10:113248883-113248905 GAACACGGTGTTTTGGGGGCAGG - Intergenic
1076439026 10:130466810-130466832 GACTCAGGAGGGCTGGGGGCAGG - Intergenic
1077176950 11:1195408-1195430 GACCAAGGAGGGGTGGGTGTTGG + Intronic
1077539852 11:3141398-3141420 AACCAAGGAGGCCTCGGGGCTGG - Intronic
1079080193 11:17408531-17408553 AACAAACGTGGTTTGGGGGCTGG + Intronic
1081319007 11:41667664-41667686 GACAAAGCAGTTTTGGGGGTGGG + Intergenic
1082784882 11:57311369-57311391 CCCCAAGGCGGGTTGGGGGCGGG - Intronic
1083306810 11:61765774-61765796 CACCAGGGAGGTCTGAGGGCCGG + Intronic
1083829537 11:65222587-65222609 GACCAAGGAGGTAAGCGAGCTGG + Intergenic
1083886798 11:65577002-65577024 GACCTAGGAGGTTGTGGGTCCGG + Intronic
1083899169 11:65635475-65635497 GCCCAAGGGGGTTTGGGGCAGGG - Intronic
1084696183 11:70756921-70756943 GGCCCAGGAGGTTTGGAGCCTGG - Intronic
1084770278 11:71338349-71338371 AACCAAGGGGGTTGGAGGGCTGG + Intergenic
1084940578 11:72610579-72610601 GACCAAGGAAGCCTGGGGGTTGG - Intronic
1085076601 11:73597713-73597735 ACCCAAGCAGGTTGGGGGGCGGG - Intronic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1085273506 11:75283833-75283855 GAGCAGGGAGTTGTGGGGGCAGG + Intronic
1085672228 11:78477940-78477962 GACCAACCACGTTTGAGGGCGGG - Intronic
1087013169 11:93532387-93532409 GAACCTGGGGGTTTGGGGGCAGG - Intronic
1087181334 11:95145206-95145228 GTCCTAGGAGGATTTGGGGCTGG + Intergenic
1088223931 11:107598613-107598635 GTGCAAGGAGGTTTGGGGAAAGG - Intronic
1089644592 11:119870381-119870403 GGCCAAGCAGGTTTGGGAGAAGG - Intergenic
1089734274 11:120539000-120539022 ACCCAAGAAGCTTTGGGGGCAGG - Intronic
1089849720 11:121485705-121485727 AACCTAGGTGGTTTGGGAGCAGG + Intronic
1089932830 11:122331570-122331592 GAGCAGGGAGGTTGGGAGGCAGG - Intergenic
1091176523 11:133563304-133563326 GACCATGGAGGGTAGGTGGCTGG - Intergenic
1091658183 12:2361084-2361106 GACTAGGAAGGTTGGGGGGCTGG + Intronic
1091816560 12:3443341-3443363 GACAAAGCCGGTTTGGGGGATGG - Intronic
1094475912 12:30840415-30840437 GCCCAAGGAGGTGTGAGGGTGGG + Intergenic
1096815260 12:54197794-54197816 GTCCCAAGAGGCTTGGGGGCAGG + Intergenic
1101775546 12:107789819-107789841 TAACAAGGAGGGTTGGGGGTGGG + Intergenic
1102896452 12:116602120-116602142 GAGAGAGGAGGTTGGGGGGCGGG - Intergenic
1103215498 12:119198553-119198575 GAGCAAGCAGGGTTTGGGGCAGG + Intronic
1103762991 12:123264867-123264889 GACCAGGCAGGGTCGGGGGCAGG + Intronic
1104908401 12:132227891-132227913 GAGCAAGAAGGTGTGGGGACGGG - Intronic
1106510521 13:30408709-30408731 GAGCCAGTAGGTTTGGAGGCCGG - Intergenic
1107057883 13:36126510-36126532 GGCCAAAGGGGTTGGGGGGCGGG - Intronic
1107418844 13:40226524-40226546 CACTTAAGAGGTTTGGGGGCTGG + Intergenic
1108468485 13:50743280-50743302 GACCAAGCAGGTTTGCTGACAGG + Intronic
1109276006 13:60305244-60305266 GAACATGGAGGTTAGGGGTCCGG + Intergenic
1111429823 13:88136262-88136284 GACCAAGGAGGCATGAGGCCTGG + Intergenic
1112547866 13:100389240-100389262 TACACAGGAGGTTTGGGGGAGGG + Intronic
1113491922 13:110699031-110699053 ACCCAAGGAGGGGTGGGGGCAGG + Intronic
1114281043 14:21192582-21192604 GGCCAAGGAGGACTGGGGGCTGG + Intergenic
1114328158 14:21610639-21610661 GACCAAGGAGGTTAGATGCCAGG - Intergenic
1115315096 14:32016881-32016903 GACCAATGAGATATGGGAGCAGG + Intronic
1118764643 14:68901660-68901682 TACCAGGGAGGTCTGGGGGAGGG + Intronic
1120859988 14:89246499-89246521 GAGAAAGGAGGTGTGGGCGCTGG - Intronic
1121501683 14:94443045-94443067 GAACATGGATGTTTGTGGGCAGG - Intronic
1123018093 14:105385027-105385049 GCCCACGGAGGGTTGGTGGCTGG - Intronic
1123048945 14:105531452-105531474 GATCAAGGGGGCTGGGGGGCCGG + Intergenic
1125937186 15:43647515-43647537 GACCAGGTAGGGTTGGGGGCAGG + Intronic
1125950034 15:43744616-43744638 GACCAGGTAGGGTTGGGGGCAGG + Intergenic
1127109381 15:55651215-55651237 AACCAAGAAGTTGTGGGGGCGGG - Intronic
1128160222 15:65418727-65418749 TACCAGGCAGGCTTGGGGGCAGG - Intronic
1129689568 15:77705581-77705603 GACCAAGAAGGTGAGGTGGCAGG + Intronic
1130381902 15:83378946-83378968 GACCAAGGAGGACTGGGGAACGG + Intergenic
1131217678 15:90552750-90552772 GACCAAGGGGGTTTTGGAGCTGG + Intronic
1132074240 15:98806394-98806416 GACAAGGGAGGCTGGGGGGCTGG - Intronic
1132206208 15:99987839-99987861 CACCCAGGAGAGTTGGGGGCTGG - Intronic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1134095674 16:11416853-11416875 GAACAAGTAGGGCTGGGGGCTGG + Intronic
1136230572 16:28883143-28883165 GGCCAGGGAGGGGTGGGGGCCGG + Intronic
1136570369 16:31093255-31093277 GACCAAGGGGGATGAGGGGCGGG + Intronic
1137683715 16:50371893-50371915 GACCAAGGTGATGTGAGGGCAGG - Intergenic
1137932763 16:52604324-52604346 GAACAGGGTGGTTTGGGGTCAGG - Intergenic
1139510968 16:67428419-67428441 GACCAAGGCGGGTTGGAGGCTGG + Intergenic
1139529932 16:67537971-67537993 GCCCAAGGAGGTCACGGGGCGGG - Intronic
1139673812 16:68509550-68509572 GACCAAGGAAGTTTGTGATCTGG - Intergenic
1140049169 16:71464366-71464388 GTCGATGAAGGTTTGGGGGCAGG - Intronic
1140207419 16:72945299-72945321 GACCAAATAGTTTGGGGGGCAGG - Intronic
1141883038 16:86872493-86872515 GACCACGGAGGAGTGGGAGCTGG + Intergenic
1141940592 16:87273536-87273558 AACCAGGGAGGTCGGGGGGCAGG + Intronic
1142154736 16:88527823-88527845 GAGCAAGGAGGCCTGGAGGCAGG + Intronic
1142156657 16:88535488-88535510 GACCATGCAGGGTTGGGGGATGG - Exonic
1203122992 16_KI270728v1_random:1555240-1555262 GGCCAAGGAGGTGCCGGGGCTGG - Intergenic
1142486016 17:248130-248152 CACCAAGGAGAGCTGGGGGCAGG - Intronic
1143038175 17:4012531-4012553 GAGCAAGGAGGGTGGGGGCCAGG + Intronic
1143175260 17:4951445-4951467 GCCCAAGGAGATTTCGGAGCAGG + Intronic
1143345761 17:6247783-6247805 GAACAAGGAGCTTTGGATGCAGG + Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1147331364 17:39701006-39701028 GACCATGGAGGGGTGGGGGTGGG + Intronic
1148083431 17:44979942-44979964 GATCAAGGAGGGTATGGGGCCGG + Intergenic
1148172762 17:45537118-45537140 GACAAAGCAGGAATGGGGGCTGG - Intergenic
1148276508 17:46308331-46308353 GACAAAGCAGGAATGGGGGCTGG + Intronic
1148298624 17:46525924-46525946 GACAAAGCAGGAATGGGGGCTGG + Intronic
1148363158 17:47030416-47030438 GACAAAGCAGGAATGGGGGCTGG + Intronic
1150403967 17:64884033-64884055 GACAAAGCAGGAATGGGGGCTGG - Intronic
1150556900 17:66262691-66262713 GACCAGGGAGTGCTGGGGGCAGG + Intergenic
1150625172 17:66836694-66836716 GAGAGAGGAGGTTTGGGGGTGGG - Intronic
1151387194 17:73762292-73762314 GACCACTGAGGTCTCGGGGCAGG + Intergenic
1151508199 17:74542947-74542969 GCCCATGGAGCTCTGGGGGCTGG + Exonic
1157424938 18:47576844-47576866 GACCAAGGAGGCTGGGGACCGGG + Intergenic
1157454016 18:47810265-47810287 GGCTCAGGAGGTTTGGGGACAGG - Exonic
1159619070 18:70616892-70616914 CGCCAAAGAGCTTTGGGGGCAGG + Intergenic
1160435597 18:78849971-78849993 GCCCCAGGAGCCTTGGGGGCAGG + Intergenic
1160590943 18:79944373-79944395 GGCCAGGGAGGCGTGGGGGCGGG - Intronic
1163234428 19:16022569-16022591 GAATGGGGAGGTTTGGGGGCAGG + Intergenic
1163321231 19:16576203-16576225 GACCAGGGAGGTCCGTGGGCGGG + Exonic
1163505037 19:17700568-17700590 GAGCAAGGATGGCTGGGGGCAGG + Intergenic
1163612478 19:18308605-18308627 GGCCAGGGAGGTCTGGGGACAGG + Intronic
1164402580 19:27911835-27911857 GAGCAAGTGGGTTTGGGGGAGGG + Intergenic
1164735837 19:30540272-30540294 GACCAAGGAGGATTGTGGAAGGG + Intronic
1164853820 19:31505224-31505246 GACCGAGGAGGTCTGGGGTGAGG + Intergenic
1165007237 19:32817300-32817322 GACAAAGGAGAGTAGGGGGCTGG - Intronic
1165253680 19:34559611-34559633 GAGCAAGGAGGTCTGTGGGGTGG + Intergenic
1165272584 19:34723637-34723659 GAGCAAGGAGGTCTGCGGGGTGG - Intergenic
1166358196 19:42239914-42239936 GGACAGGGAGGTTTGGGGACTGG - Intronic
1166768504 19:45266338-45266360 AACCATGGAGGGGTGGGGGCAGG - Intronic
1168301396 19:55407210-55407232 GACCAAGCAGGGTTAGGAGCGGG - Intronic
1168408115 19:56121159-56121181 GACCAAGGAGGTGAGGGGTGGGG - Exonic
925068636 2:950156-950178 GACCCCCGAGCTTTGGGGGCGGG + Intergenic
926210554 2:10866424-10866446 GACTAAGGAGGCTTTGGGGCGGG - Intergenic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927214449 2:20659705-20659727 TCCCAAGGAGGTTTGAGGGCTGG + Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
929158704 2:38810930-38810952 CACCAAGGAGGTCTGGTGGGTGG + Intronic
931447193 2:62336579-62336601 GAGCAGGGATGTTGGGGGGCGGG - Intergenic
933983713 2:87573827-87573849 GACCAGGGAAGGTTGGGGGAGGG + Intergenic
935269303 2:101419885-101419907 GAGCAAGGAGCTTTGGGGAAGGG + Intronic
935728732 2:106047039-106047061 GGCTAAGGAGGTATGGGGGGAGG - Intergenic
936310138 2:111376967-111376989 GACCAGGGAAGGTTGGGGGAGGG - Intergenic
937049998 2:118880852-118880874 GGCCAAGGAGGTTTCCAGGCAGG + Intergenic
937103272 2:119288028-119288050 CACAAAGGAGGTTTTGGGGGTGG + Intergenic
939643126 2:144664357-144664379 CAGCAAGCTGGTTTGGGGGCAGG + Intergenic
940089347 2:149898496-149898518 GGACAAGGAGGTCTGGGGTCTGG - Intergenic
940125241 2:150315259-150315281 GACTAAGAAGCTTTTGGGGCCGG - Intergenic
940504522 2:154535881-154535903 GACCAGGGAGATTTGGCTGCTGG + Intergenic
940858280 2:158746807-158746829 GACCCTGGAGGTTTGAGGGCAGG + Intergenic
942009895 2:171751002-171751024 GACCAGGGAGGTTGGGGAGATGG + Intergenic
942183746 2:173404781-173404803 GAGCAAGGTGGTTGGGTGGCCGG - Intergenic
942458897 2:176156415-176156437 GACCAAAAAGGTCTGGGGCCTGG - Intronic
944772933 2:202932492-202932514 TACCCTGGAGGTTTGGGAGCAGG + Intronic
945276964 2:207997788-207997810 GACCCAGGAGATCTGGGGTCAGG - Intronic
946563297 2:220936997-220937019 GCAAAAGGAGGTTTGGGGGAAGG + Intergenic
947235239 2:227934737-227934759 GACCACGGGGGATTGGGGGGGGG + Intergenic
947406986 2:229788617-229788639 GACTAGGCAAGTTTGGGGGCTGG - Intronic
948677080 2:239602998-239603020 GCCCACGGAGGCCTGGGGGCAGG + Intergenic
948958931 2:241316436-241316458 GGGCTTGGAGGTTTGGGGGCTGG - Exonic
1170044667 20:12072564-12072586 GACCAAGGGGATCTGGGGGTGGG - Intergenic
1171263553 20:23752586-23752608 GACCAAGGAGTCTATGGGGCCGG - Intergenic
1171846547 20:30280911-30280933 GGCCATGGAGGGTTGGGGGTGGG + Intergenic
1172298633 20:33832144-33832166 GACAACGGAGGTATGGGGGCTGG - Intronic
1172989047 20:39018321-39018343 GAACCAGGAGAGTTGGGGGCCGG + Intronic
1173495509 20:43514836-43514858 GCCCCAGAAGGTTCGGGGGCGGG + Intronic
1174376389 20:50129214-50129236 GAACAAGGTGGGTTGGGTGCAGG + Intronic
1175112411 20:56657928-56657950 ATCCAAGGAGGTTGGGGGGTAGG + Intergenic
1179124154 21:38576806-38576828 GCCCAGGGAGGTTGGGCGGCAGG - Intronic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1179403078 21:41102375-41102397 GACCAAGCAGGGGTGGGGGAGGG + Intergenic
1181573181 22:23778899-23778921 GGCCAATGAGGTCTGGGGGTGGG - Intronic
1181688698 22:24546255-24546277 GAAAATGGGGGTTTGGGGGCCGG - Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1183327412 22:37202002-37202024 GCACTAGGAGGGTTGGGGGCTGG - Intergenic
1184015060 22:41779815-41779837 AACCGAGGAGGTTTGGGGTGTGG - Intronic
1184501978 22:44879908-44879930 GACCAAGGTGATTTTGGGGTGGG + Intergenic
1185231948 22:49688513-49688535 GACCAAGGAGGTCCTGGGGAAGG + Intergenic
949973346 3:9430369-9430391 GAGAAAGGAGGGTTGGGGGTGGG + Intronic
950138439 3:10599435-10599457 GAACAAGGTGATGTGGGGGCTGG - Intronic
952313725 3:32213911-32213933 GGCCAAGGAGGCTTGAGGCCAGG - Intergenic
952360746 3:32627829-32627851 GTCCAAGGAGGTCAGGGGGTGGG + Intergenic
952735785 3:36690349-36690371 CAGCAAGGAGGTTTGGGGGACGG + Intergenic
953269849 3:41430891-41430913 AAGCAATGAGGTTTGGGGGTGGG + Intronic
956285293 3:67602401-67602423 GATCAAGGCGGGTTGTGGGCAGG - Intronic
957056144 3:75444541-75444563 GCCCACGGAGGGTTGGGGGGAGG + Intergenic
957199323 3:77112225-77112247 GATCAAGGAGTTTTGGGGGGTGG + Intronic
959857305 3:111174711-111174733 AACCACTGAGGTTTGGGGGGTGG + Intronic
961359523 3:126358042-126358064 GACTAAGGAGGTTTGCTGACCGG + Intergenic
961489204 3:127240826-127240848 CACCCAGGAGGTTGGGGGGTGGG + Intergenic
961574370 3:127822866-127822888 GGACAAGTTGGTTTGGGGGCTGG + Exonic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
964397268 3:156258537-156258559 GACCAAGGAGAATTGGCAGCAGG - Intronic
964720498 3:159764300-159764322 CCCCAAGGAGGCCTGGGGGCGGG - Intronic
968589884 4:1452055-1452077 GCCCAAGGAGGTTGAGGGGTAGG + Intergenic
968622208 4:1608918-1608940 GACCATGCGGGTTTGGAGGCGGG + Intergenic
972844750 4:42974189-42974211 GATCATGGAGGGTAGGGGGCTGG + Intronic
978409813 4:108415178-108415200 CTCCCAGGAGATTTGGGGGCAGG + Intergenic
978746667 4:112202414-112202436 GACCAAGCATGTTTTGGGGTTGG - Intergenic
982380151 4:154741188-154741210 GACGAAGGGGGGTCGGGGGCGGG + Intronic
983499250 4:168480378-168480400 GACCTAGCAGGTTCGGCGGCCGG - Exonic
986751637 5:10792952-10792974 GACCAAGGAAGTTTTGGAGCAGG - Intergenic
988927505 5:36004362-36004384 GCCCAAGGTGGTTGGGGTGCAGG - Intergenic
989683313 5:44055180-44055202 GACTAGGGTGGTTAGGGGGCAGG + Intergenic
995064450 5:107844208-107844230 GAAGAAGGAGATCTGGGGGCTGG + Intergenic
998985786 5:147754937-147754959 CATCAAGGAGCTTTGGGGGTAGG + Intronic
1000043195 5:157500552-157500574 AGCCTAGGAGGGTTGGGGGCAGG - Intronic
1001758832 5:174191223-174191245 GTCCAAGGAGGTTGAGGGGGTGG + Intronic
1004032016 6:11879882-11879904 CACCAAGTAGGTATGGGGCCAGG + Intergenic
1004895442 6:20143389-20143411 GGTCAAGGAGGCCTGGGGGCCGG + Intronic
1005715897 6:28548038-28548060 GACTCAGGAGGTGTGGGGGGAGG + Intergenic
1006108070 6:31728537-31728559 GGCCGCGGAGGTTTGAGGGCGGG + Intronic
1006483386 6:34317174-34317196 GGCGAAGCAGGTTTGGGGGAAGG + Intronic
1007406562 6:41638978-41639000 GTCCAAGGAGAGTAGGGGGCTGG + Intronic
1007625350 6:43243521-43243543 GCCCAAGGAGGATCGGGGCCGGG + Intergenic
1008682718 6:53891193-53891215 AACAAAGGAAGTTGGGGGGCAGG - Intronic
1008830978 6:55761524-55761546 CAGCAAGGAGGTATGGTGGCTGG - Intronic
1014258326 6:119186566-119186588 AACCAAGGAGGTTTTGGAGTTGG - Intronic
1017635216 6:156436605-156436627 GACTAAGGAGATTTGGGGATTGG - Intergenic
1023598042 7:41853255-41853277 GACAAAGGAGGTTGGGGGAATGG + Intergenic
1023835764 7:44066275-44066297 ATCCAAGGGGGTTTGGGGGCAGG + Intronic
1024232450 7:47373023-47373045 GACCACGGAGGTGTAGGTGCAGG - Intronic
1025872081 7:65444253-65444275 GACTAATGGGGGTTGGGGGCAGG + Intergenic
1030059100 7:105608940-105608962 GACCAGGAAGGATTGGGGGGTGG - Intronic
1031922032 7:127609199-127609221 GGCCAAGGTGGTAGGGGGGCTGG + Intergenic
1032404992 7:131649532-131649554 AACCAAGGAGGGGTGGTGGCAGG - Intergenic
1032497943 7:132376826-132376848 GATCAAGGAGGACTGGGTGCAGG - Intronic
1033646478 7:143308774-143308796 GGGCAAGGGGGTTGGGGGGCGGG - Intergenic
1036406692 8:8461577-8461599 GCCCAAGGTGGTTTGGGGTTGGG + Intergenic
1037967787 8:23147171-23147193 CACCAAGGAGTTCTGAGGGCTGG + Intronic
1038758202 8:30361473-30361495 TACCAAGGAATTTTGGGGGGGGG - Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1041220302 8:55644297-55644319 GACCTAGGAGCTTTTGGGGAGGG + Intergenic
1042287037 8:67124906-67124928 GACCAAGGTGGTTTGAGGCCAGG - Intronic
1045582281 8:103495246-103495268 GACCAGGGAGGGTGTGGGGCAGG + Intergenic
1045814432 8:106262832-106262854 GCCCGAGGAGGTTGGGGAGCAGG - Intergenic
1047288181 8:123506324-123506346 CACCAAGGAAGTTTGGGGTGAGG + Intronic
1048213917 8:132479437-132479459 GAGCCAGGAGGTGAGGGGGCCGG - Intronic
1049277061 8:141725219-141725241 GAGCAAGGTGGCTTGGAGGCTGG - Intergenic
1049429247 8:142551540-142551562 CACCACTGAGGTTTGGGGCCAGG - Intergenic
1049795035 8:144493320-144493342 TTCCAAGGAGGTTTGGGGGAAGG + Intronic
1051065188 9:13094002-13094024 GACCAAGGAGCCTTGGGGAGAGG - Intergenic
1051440771 9:17080290-17080312 GACCCAGGAGGGTTGGGGAGGGG + Intergenic
1055626127 9:78178987-78179009 TACCAAGGAGGTCTGGTGGGTGG - Intergenic
1055968985 9:81892898-81892920 GGCAAAGGAGGTTTTGGGGAAGG - Intergenic
1057410244 9:94811465-94811487 GACGGAAGAGGTCTGGGGGCAGG - Intronic
1057466196 9:95317006-95317028 GGCGAATGGGGTTTGGGGGCAGG + Intronic
1058868673 9:109183992-109184014 GACCAAAGAAATTTGGGGGAAGG - Intronic
1058999587 9:110334730-110334752 GGCCAGGGAGGGATGGGGGCTGG + Intronic
1061041714 9:128144562-128144584 TGCCAAGGAGGAGTGGGGGCTGG + Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061773657 9:132946086-132946108 GGCCCAGGAGGGTTTGGGGCTGG - Intronic
1061878029 9:133554623-133554645 GACCAACGAGGTGTGCGAGCAGG + Exonic
1062070814 9:134554092-134554114 GAGCAGGGGGGTGTGGGGGCTGG + Intergenic
1062474110 9:136719104-136719126 GACCAAGGAGGTGGAGGGGCCGG + Intronic
1185662935 X:1741445-1741467 GGCCAAGGGGGGGTGGGGGCGGG + Intergenic
1186371247 X:8949601-8949623 GAGCAGGGATGTTTGGGGACAGG + Intergenic
1186760052 X:12713746-12713768 GAAGAATGTGGTTTGGGGGCTGG - Intronic
1186932934 X:14414506-14414528 GACCAAGGGGGAATGGGGGTTGG + Intergenic
1186990343 X:15060248-15060270 AAAGAAGTAGGTTTGGGGGCAGG + Intergenic
1189406734 X:40732220-40732242 CATCAAGAAGGTTTGGAGGCTGG + Intronic
1190248787 X:48707272-48707294 GACCAAGGATCTTTGGGGCTGGG - Intronic
1193412581 X:81182554-81182576 GACCAAGGAAGCTTGGGGTGGGG - Intronic
1194134019 X:90116444-90116466 GAACCAGGAGGTTTGGGCACAGG + Intergenic
1194232627 X:91342886-91342908 GACCAAGGAGGTTTTGAAACTGG + Intergenic
1200479798 Y:3686559-3686581 GAACCAGGAGGTTTGGGCACAGG + Intergenic