ID: 1040425527

View in Genome Browser
Species Human (GRCh38)
Location 8:47281261-47281283
Sequence CTGACTGATCAGATGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040425524_1040425527 -5 Left 1040425524 8:47281243-47281265 CCTTGATGCTGATGGCTGCTGAC 0: 10
1: 145
2: 298
3: 501
4: 727
Right 1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG No data
1040425518_1040425527 30 Left 1040425518 8:47281208-47281230 CCAAGGTATAATCTTTTTGCTGG 0: 1
1: 0
2: 8
3: 18
4: 141
Right 1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040425527 Original CRISPR CTGACTGATCAGATGGTTGG TGG Intronic
No off target data available for this crispr