ID: 1040434879

View in Genome Browser
Species Human (GRCh38)
Location 8:47380515-47380537
Sequence GGCTCAAGAAAGGCACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040434879_1040434891 25 Left 1040434879 8:47380515-47380537 CCGGCAGGTGCCTTTCTTGAGCC 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1040434891 8:47380563-47380585 CGCTGTCTGTCATTTCTCCTTGG No data
1040434879_1040434892 26 Left 1040434879 8:47380515-47380537 CCGGCAGGTGCCTTTCTTGAGCC 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1040434892 8:47380564-47380586 GCTGTCTGTCATTTCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040434879 Original CRISPR GGCTCAAGAAAGGCACCTGC CGG (reversed) Intronic
900160387 1:1220491-1220513 GGCTCAGGAAGAGCAGCTGCCGG - Intronic
902622902 1:17660688-17660710 GTCTCAGCAAAGGCACCTTCAGG - Intronic
903678232 1:25079947-25079969 GTCTCTAAAAAGTCACCTGCTGG - Intergenic
903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG + Intronic
905274717 1:36809768-36809790 GACACAAGAAAGGCACCAGTGGG + Intronic
906821963 1:48939501-48939523 AGCTCAAGAAAGGGGCCTCCAGG + Intronic
907725619 1:57017588-57017610 GGCTCCAGAGAGGCACCAACAGG + Intronic
912998038 1:114551530-114551552 GGCTCAAGCAATCCTCCTGCTGG - Intergenic
913606226 1:120468892-120468914 GGCTAAAGAAAATCACCTGAGGG + Intergenic
914210208 1:145571260-145571282 GGCTAAAGAAAATCACCTGAGGG - Intergenic
914269125 1:146063622-146063644 GGCTAAAGAAAATCACCTGAGGG - Intergenic
914367971 1:146997243-146997265 GGCTAAAGAAAATCACCTGAGGG + Intergenic
914485009 1:148100965-148100987 GGCTAAAGAAAATCACCTGAGGG - Intergenic
914584972 1:149052949-149052971 GGCTAAAGAAAATCACCTGAGGG - Intergenic
915534213 1:156525065-156525087 GGCTCAGGAAAAGAACCTGCAGG + Intergenic
915543229 1:156581916-156581938 TGCTCAAGAGAGACAGCTGCGGG + Exonic
917000668 1:170354659-170354681 GGCTCAAGAAAGGGACCCTGGGG - Intergenic
918042349 1:180920926-180920948 AGCTCAAAAATGGCAGCTGCTGG - Intronic
920286138 1:204881223-204881245 GGCTCAACAGATGCATCTGCTGG - Intronic
922043155 1:221916846-221916868 GTCTCAAGAAACGCACCAGGTGG + Intergenic
922751984 1:228074337-228074359 TGCCCAGGAAAGGAACCTGCAGG + Exonic
923048453 1:230372848-230372870 GGAGGAAGAAAGCCACCTGCAGG - Intronic
923533582 1:234830871-234830893 AGCTGATGAGAGGCACCTGCAGG - Intergenic
1062972867 10:1661931-1661953 GGCTGAAGAAAGGGAAATGCAGG + Intronic
1063672362 10:8109547-8109569 GGTTCCTGAAAGGCACCTTCTGG - Intergenic
1067317614 10:45182889-45182911 GGCTCAAGTAATTCTCCTGCAGG - Intergenic
1067557971 10:47285536-47285558 GGCAGAAGACAGCCACCTGCAGG + Intergenic
1070547674 10:77465375-77465397 GGCTCCAGGATGGCACCTCCTGG + Intronic
1070744539 10:78925330-78925352 GGCACATGAAAGGCACTCGCTGG - Intergenic
1071907650 10:90191786-90191808 ATATCAAGACAGGCACCTGCTGG - Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1075567794 10:123517441-123517463 GACTCCAGAAAGGCATCAGCAGG - Intergenic
1076731036 10:132439009-132439031 GGCTCTGGAAAGGCACCGTCAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077054046 11:581591-581613 AGCTCACCAAAGTCACCTGCCGG - Exonic
1077203177 11:1324020-1324042 GGCTAATGAGAGGCACCTGCAGG - Intergenic
1077269408 11:1668176-1668198 TGCTCCAGGAAGGCGCCTGCGGG - Intergenic
1079048102 11:17127152-17127174 GGCTAAAGAAAGGCAGTTGAAGG - Intronic
1079055568 11:17203770-17203792 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1079061247 11:17250889-17250911 TGATCAAGAAAGGCAGCAGCTGG - Intronic
1079977790 11:27113679-27113701 GGATCAAGAAAATCACCTACTGG + Intronic
1084403350 11:68957219-68957241 GGCTCAAGGAGGGCACCTGATGG + Intergenic
1084566944 11:69935232-69935254 AGCACAAGAAAGGTGCCTGCAGG - Intergenic
1085764328 11:79269990-79270012 GGCCCTGGAAAGGAACCTGCTGG - Intronic
1090017312 11:123097730-123097752 GACTGAAGAAAGGCAAATGCAGG + Intronic
1096750747 12:53757293-53757315 GGCTCCAGAAAGGAAGCAGCCGG - Intergenic
1096813075 12:54183882-54183904 GGCTCCATGAGGGCACCTGCAGG + Exonic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1101860031 12:108475335-108475357 GGCTCCAGAAAGGCAGGGGCAGG + Intergenic
1104093708 12:125537392-125537414 GACTCATTAAAGCCACCTGCTGG + Intronic
1106722642 13:32451780-32451802 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1110751369 13:79119742-79119764 GGCTCAGGCATGGCAGCTGCAGG + Intergenic
1111692887 13:91586689-91586711 ATATCAAGAAAGGGACCTGCTGG - Intronic
1113166650 13:107450475-107450497 GGTTCAAGAAAACCAACTGCAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1117160008 14:52979932-52979954 GACTCAAGAAAGGCCTCAGCCGG - Intergenic
1119072937 14:71606244-71606266 CCCACAACAAAGGCACCTGCAGG + Intronic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1119840610 14:77790138-77790160 GGCTCAAGCAATTCTCCTGCTGG + Intergenic
1119970497 14:78964976-78964998 GGATCAAGCCAGGCACCTCCCGG - Intronic
1121275286 14:92663341-92663363 GGAGCAAGAAAGGCAGCTGCTGG + Intronic
1122370006 14:101224466-101224488 GGCTCGACATGGGCACCTGCAGG - Intergenic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1122749269 14:103920764-103920786 GACTCAAGAAAGGGGCCGGCCGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1124426423 15:29567150-29567172 GGCACAGGAAAACCACCTGCAGG + Intronic
1126122935 15:45269628-45269650 GACCCCAGAAAGGCATCTGCAGG - Intronic
1126373356 15:47970229-47970251 AGCTCAAAGAAGGCACCTGGGGG + Intergenic
1128242372 15:66109747-66109769 GGGTCAAGAAAGACCCCTTCAGG - Intronic
1128905776 15:71466523-71466545 GACTCAAGGAAGGCTCCTGAGGG - Intronic
1129145158 15:73640439-73640461 TGGTCAAGAAAGGCTCCTGGAGG + Intergenic
1129189110 15:73927320-73927342 GGCTGACGAAGGGCGCCTGCGGG - Exonic
1129681908 15:77662928-77662950 GGGACAAGCAAGGCCCCTGCAGG + Intronic
1130661017 15:85831351-85831373 GGCAAAACAAAGGCACCTCCAGG + Intergenic
1131837812 15:96408547-96408569 GGCTCCAGGAAGGCAGCTGCCGG + Intergenic
1132045825 15:98562149-98562171 GGCCACAGAAAGGCTCCTGCTGG - Intergenic
1132119605 15:99165639-99165661 TGCTCCAGAAATGCATCTGCTGG - Intronic
1132611193 16:817099-817121 GCCTCCAGAAAGGCCGCTGCGGG - Intergenic
1133682250 16:8130559-8130581 CACTCAAGAAAGGCGACTGCAGG - Intergenic
1134091203 16:11392504-11392526 GGAGCCAGAAAGGGACCTGCTGG + Intronic
1135137863 16:19898176-19898198 GGCATGAGAAAGCCACCTGCCGG + Intergenic
1135475695 16:22772565-22772587 GGCTCCAGGAAGGCACTTGGTGG - Intergenic
1135667599 16:24349151-24349173 GGGTCAGGAAAGGGACCGGCAGG - Intronic
1140438610 16:74969155-74969177 GTCTGAAGAAAGGTGCCTGCTGG + Intronic
1141878568 16:86842769-86842791 GGTGTATGAAAGGCACCTGCCGG - Intergenic
1142280268 16:89144390-89144412 GGCACAAGATGGGCACCAGCAGG + Intronic
1143437912 17:6942970-6942992 GGCACAAGAAAGGCAGGTACTGG - Intronic
1143666427 17:8364512-8364534 TGCTGAAGAAAGGCCACTGCGGG - Intergenic
1144556513 17:16287110-16287132 GGCTGGAGAAAGGCATCTGGAGG - Intronic
1145246446 17:21272895-21272917 AGCAAGAGAAAGGCACCTGCAGG - Intergenic
1147981692 17:44278703-44278725 GGCTCAAGCAATCCACCCGCCGG - Intergenic
1148119247 17:45197958-45197980 GGCTCAACAGCGGCACCTGCCGG + Intergenic
1149015259 17:51901528-51901550 GGCTAAAGAAAGGTACCAGTGGG + Intronic
1150145937 17:62769506-62769528 GGCACAAGAATTGAACCTGCAGG - Intronic
1151675905 17:75597210-75597232 GGCTCATGAAGGGCTTCTGCAGG + Intergenic
1152519432 17:80846568-80846590 GTCTGAAGAAACTCACCTGCAGG - Exonic
1152740601 17:82016793-82016815 GGCTCCAGGTAGACACCTGCAGG - Exonic
1203166536 17_GL000205v2_random:102288-102310 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1153027428 18:684294-684316 GGCTCAAGAAATCCACAGGCTGG - Intronic
1156310144 18:35914708-35914730 GGCTAAAGAAGGGCAGCTCCAGG - Intergenic
1156648446 18:39196044-39196066 TGCTCAAGAATGGCCTCTGCTGG - Intergenic
1159919588 18:74215528-74215550 CCCTCAAGAATGGCAACTGCTGG - Intergenic
1161393221 19:4031990-4032012 GGCTCAAGCAGGGGAGCTGCTGG + Intronic
1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1163641023 19:18462034-18462056 TGCCCAAGGCAGGCACCTGCAGG + Intronic
1168361678 19:55746048-55746070 GGGACAAGAATGGCAGCTGCGGG - Intergenic
933090611 2:78111596-78111618 GGTGCAAGCAGGGCACCTGCAGG - Intergenic
934066980 2:88349953-88349975 GGCTGAAGGTAGGCACGTGCAGG + Intergenic
936557336 2:113508251-113508273 TGCCCAAGAAAGCCACCTGGAGG + Intergenic
942552853 2:177137799-177137821 GGCTCCAGAGAGCCAGCTGCGGG - Intergenic
944551631 2:200849763-200849785 GGCTCAAGCAATTCACCTGGGGG - Intergenic
945163555 2:206918703-206918725 GGGTAAAGAGAGGCAGCTGCAGG - Intergenic
945646208 2:212498210-212498232 GGTTCAAAAAAGGGACTTGCAGG - Intronic
945671549 2:212808160-212808182 TGCTCAAGAAATGAATCTGCAGG + Intergenic
947821327 2:233073089-233073111 GGCTGAAGCGAGGCACCAGCAGG - Intronic
948334334 2:237195570-237195592 GTCTCAAGAAAGGCCTCTCCAGG - Intergenic
948507096 2:238435668-238435690 GGCTCATGAGAGGCAGCCGCAGG - Intronic
948731224 2:239964934-239964956 GTCTTAAGAGAGGCGCCTGCTGG - Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1168820104 20:767085-767107 GGCTAATTAAAGGGACCTGCTGG + Intronic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1170773231 20:19352167-19352189 GACTCAAGAAAGGCAACTTTGGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172779244 20:37426029-37426051 GGCACAAGGCCGGCACCTGCTGG + Intergenic
1174025452 20:47570207-47570229 GGCTCAAGCAATCCGCCTGCTGG - Intronic
1174402167 20:50282054-50282076 GTCTCAAGCCAGGTACCTGCAGG - Intergenic
1175142390 20:56870667-56870689 TGCTTTAAAAAGGCACCTGCAGG + Intergenic
1175272133 20:57741829-57741851 GGCTCAGGACTGGCACCAGCCGG + Intergenic
1176335002 21:5588257-5588279 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176392755 21:6232691-6232713 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1176405219 21:6356808-6356830 GGCGCAAGAGAATCACCTGCGGG + Intergenic
1176431938 21:6632295-6632317 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1176468664 21:7083483-7083505 GGCGCAAGAGAGTCACCTGCGGG + Intronic
1176492225 21:7465261-7465283 GGCGCAAGAGAGTCACCTGCGGG + Intergenic
1176508417 21:7673122-7673144 GGCGCAAGAGAGTCACCTGCGGG - Intergenic
1177072904 21:16533240-16533262 TGCTAAAGAAAGTCACCTGAAGG + Intergenic
1177220013 21:18180374-18180396 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1182351485 22:29702475-29702497 GGCCCAAGGAGGGCCCCTGCTGG - Intergenic
1182928230 22:34147648-34147670 AGGTCAAGAAAGGTACCTACAGG + Intergenic
1183343335 22:37294119-37294141 TGCTCCAGAAAGACACCAGCCGG + Intronic
1183641051 22:39092685-39092707 GGCTCATCAATGGAACCTGCCGG + Intergenic
1184728023 22:46357590-46357612 GCCTCAAGACAGGTTCCTGCGGG + Intergenic
1185383807 22:50522494-50522516 GGCTCTAGAAAGTCATCTGCTGG - Exonic
954444121 3:50537464-50537486 GGCACAGGGAAGGCACCTCCTGG + Intergenic
954803261 3:53199652-53199674 GTCTCAAAAAAGGCAGCAGCAGG + Intergenic
955476903 3:59346584-59346606 GGCCATAGAAAGTCACCTGCTGG + Intergenic
961707417 3:128798374-128798396 GGCACAAGACAGAGACCTGCAGG - Intronic
963084913 3:141427754-141427776 GGCTCATGCTAGGGACCTGCCGG - Intronic
964416745 3:156455772-156455794 TGCTTAAGAAAGGCAGCTGCCGG + Intronic
969864532 4:10065637-10065659 AACTCAAGGAAGTCACCTGCCGG + Intergenic
972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG + Intergenic
972570202 4:40303628-40303650 GGATCCAGAAAGGCAGCTTCGGG + Intergenic
975022301 4:69503765-69503787 GGCTGAAGCAAGGCAACTGGAGG - Intronic
977067233 4:92333365-92333387 GTTTCCAGAAAGGCACCTGTGGG - Intronic
980328784 4:131383978-131384000 CTCCCTAGAAAGGCACCTGCTGG - Intergenic
982088635 4:151861539-151861561 GGCTCATGACAAGCATCTGCTGG - Intergenic
983172343 4:164550104-164550126 GGCTCCAGGAAGGCAGCAGCAGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985848992 5:2374781-2374803 AGCTCAAGAAAGCCACCTATGGG + Intergenic
987038460 5:14040286-14040308 GGGACATGAGAGGCACCTGCTGG + Intergenic
987642996 5:20634815-20634837 CGCTTAAGAAAGCCACCTGGAGG + Intergenic
987752618 5:22060702-22060724 GTCTCAAAAAAAGAACCTGCAGG - Intronic
988417078 5:30959192-30959214 GACACAAGAAAGGGACCTTCTGG - Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
992250792 5:74874127-74874149 GGCTCAAGTCAGGAACCTGATGG - Intergenic
992762386 5:79962202-79962224 GGCCCAAGGAAGGCCGCTGCCGG - Intergenic
992799706 5:80284830-80284852 GGTTCAATATAGGCACCTGGTGG + Intergenic
996092149 5:119361883-119361905 GGCTCAAAGAAGGCAGCAGCAGG - Intronic
996839132 5:127827360-127827382 GGCCCAAGAAAAGCAAATGCTGG - Intergenic
997602039 5:135147011-135147033 GGCTGAGGGAAGGCACCTGGGGG + Intronic
999253551 5:150196709-150196731 GGCACGAGGAAGGCGCCTGCCGG - Exonic
1000892795 5:166818812-166818834 GGCTCAAGCAAGGCAGCTGTTGG + Intergenic
1003481653 6:6539549-6539571 GGCTCAAGAAAGGGACTTGGTGG - Intergenic
1006777800 6:36609736-36609758 GGCTTAAGAAAGGCTCCTTTGGG + Intergenic
1006793030 6:36716022-36716044 GAGTGAAGAAAGGCACCTGCAGG - Intronic
1007656511 6:43454395-43454417 TGCTCAGGACAGGTACCTGCAGG + Exonic
1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG + Intergenic
1013033238 6:106356582-106356604 GGCTCAAGGAAGTCATCAGCAGG - Intergenic
1013400203 6:109786924-109786946 GGCACTACAAAGGCACTTGCGGG - Intronic
1013447816 6:110248686-110248708 GGCTCAAGTGATCCACCTGCTGG - Intronic
1017311867 6:152984223-152984245 GGCTGCAGAAAGGCACCAGAGGG - Intergenic
1018185807 6:161264636-161264658 GGCTCCTCAAAGGCACTTGCAGG + Intronic
1019597123 7:1863346-1863368 GGCTGCAGAAAGGCAGCTACCGG + Intronic
1020015710 7:4830304-4830326 GGCCCTAGAGAGACACCTGCTGG - Intronic
1021604423 7:22395837-22395859 GGCTCAACAATGGCTACTGCAGG - Intergenic
1023131797 7:37011011-37011033 GGCTCAGGACAGGCAGCTCCAGG - Intronic
1024008072 7:45241861-45241883 GAGACAAGCAAGGCACCTGCTGG - Intergenic
1026523340 7:71134431-71134453 GGCTCACCAAAGGTCCCTGCTGG + Intronic
1026569625 7:71517985-71518007 AGCTCATGAAAGGCCCCTGGGGG + Intronic
1030775090 7:113524540-113524562 GGCTCAAGGAAGGAACCTGAAGG - Intergenic
1034450620 7:151135324-151135346 GGCACAGGAATGGCACCAGCAGG - Intronic
1035470488 7:159106105-159106127 GGCTCAGGATAGGGGCCTGCAGG - Intronic
1035641258 8:1186783-1186805 GGTTCATGGAAGCCACCTGCAGG + Intergenic
1037425212 8:18748183-18748205 GGCTGAAGAAAAGCAACTGTGGG + Intronic
1039063858 8:33592969-33592991 GGCTTAAGAAATCCTCCTGCTGG + Intronic
1039935336 8:42039020-42039042 GGCTGATGAAAGCCATCTGCTGG + Intronic
1040360467 8:46659436-46659458 TGCTCAAGCAAGCCACCTGTGGG + Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1042815655 8:72875305-72875327 GGCTCATGGACAGCACCTGCAGG - Intronic
1043483767 8:80678875-80678897 GGCTAATGAGAGGCACCGGCAGG + Intronic
1045714129 8:105021675-105021697 AGATCAAGGAAGGCACCAGCAGG - Intronic
1047258600 8:123235891-123235913 GGCTACAGAAAGGCACCGGAAGG + Intronic
1049432991 8:142573866-142573888 GGGTCATGAGAGGGACCTGCGGG + Intergenic
1049551236 8:143260961-143260983 GGCTCAGGGATGGGACCTGCAGG - Intronic
1049895665 9:109048-109070 TGCCCAAGAAAGCCACCTGGAGG - Intergenic
1049994073 9:1018134-1018156 GGCACAAGAAAGACACTTGTGGG - Intergenic
1050739696 9:8805697-8805719 GGTTCAAGAAATTCTCCTGCTGG + Intronic
1051677609 9:19573793-19573815 GGCTCAAGAAAGGCATATCATGG - Intronic
1053281865 9:36825754-36825776 TTCACAAGAAAGGCACCGGCTGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054689500 9:68312089-68312111 TGCCCAAGAAAGCCACCTGGAGG + Intergenic
1055300642 9:74878287-74878309 CACCCAAGAAAGTCACCTGCAGG + Intronic
1057780462 9:98045773-98045795 TGATCAAGCAAGGTACCTGCAGG + Intergenic
1061042811 9:128149669-128149691 GGGCCAAGAGGGGCACCTGCAGG + Intronic
1061242187 9:129381249-129381271 CGCTCAAGAAATGCTACTGCCGG + Intergenic
1061400852 9:130367591-130367613 GGCTCAATAAAGGCTACTGAAGG - Intronic
1062042084 9:134408822-134408844 GGCCTCAGAAAGGGACCTGCTGG - Intronic
1203426638 Un_GL000195v1:46659-46681 GGCGCAAGAGAATCACCTGCGGG - Intergenic
1203439601 Un_GL000195v1:176413-176435 GGCGCAAGAGAATCACCTGCGGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185550263 X:977464-977486 GGATGAAGACAGGCAGCTGCTGG - Intergenic
1188743739 X:33816978-33817000 GGCACAAGCAAGGCAGCTGAGGG + Intergenic
1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG + Intergenic
1191782839 X:64886819-64886841 GGCTCATGAAAACCACGTGCAGG - Intergenic
1196014120 X:110919358-110919380 GGTTCAAGAAAGCCACCTCTGGG - Intergenic
1200831108 Y:7689497-7689519 GGTTCAATAAAGGTAGCTGCAGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic