ID: 1040435043

View in Genome Browser
Species Human (GRCh38)
Location 8:47381913-47381935
Sequence CTGGTAGAACAAAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040435043_1040435050 1 Left 1040435043 8:47381913-47381935 CCATCCTCCCTTTGTTCTACCAG 0: 1
1: 0
2: 5
3: 40
4: 397
Right 1040435050 8:47381937-47381959 TGGGTAGCATTTAGCTACAAAGG No data
1040435043_1040435051 19 Left 1040435043 8:47381913-47381935 CCATCCTCCCTTTGTTCTACCAG 0: 1
1: 0
2: 5
3: 40
4: 397
Right 1040435051 8:47381955-47381977 AAAGGTGTAATTTTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040435043 Original CRISPR CTGGTAGAACAAAGGGAGGA TGG (reversed) Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
900964774 1:5950341-5950363 CTTGAAGCTCAAAGGGAGGAGGG + Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902738606 1:18418371-18418393 ATGGAAGAAGAAAGGAAGGAAGG + Intergenic
902794335 1:18791256-18791278 CTGTTAGAACCAAGGAAGGAGGG + Intergenic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
903466277 1:23554618-23554640 CTGAAAGAACGAAGGAAGGAAGG + Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
905907373 1:41627899-41627921 CTGGTATGACAAAGGAAGGAAGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910962562 1:92778291-92778313 CTGCCAGAACAAAGAGTGGAAGG + Intronic
911215187 1:95185276-95185298 TTGGTAGAACAAGGGAAGGCAGG + Intronic
911378063 1:97075945-97075967 TTGGTTGAACAAAAGGATGAAGG + Intergenic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912452053 1:109773284-109773306 CTGGGAGACCATGGGGAGGACGG + Intronic
912584960 1:110754043-110754065 GTGGTGGGAGAAAGGGAGGAAGG + Intergenic
912951395 1:114123039-114123061 CTGGAAGCAAAAAGGCAGGAAGG - Intronic
913481313 1:119291971-119291993 AAGGAAGAACAAAGGAAGGAAGG - Intergenic
913684034 1:121214795-121214817 CTGGTAAAAGAAGGGAAGGAAGG - Intronic
914035873 1:144002410-144002432 CTGGTAAAAGAAGGGAAGGAAGG - Intergenic
914153583 1:145065535-145065557 CTGGTAAAAGAAGGGAAGGAAGG + Intronic
917010990 1:170470673-170470695 TTGGCAGAAAAAAGTGAGGAGGG + Intergenic
917152601 1:171960804-171960826 CTGGAAGAAAAAAAGCAGGATGG + Intronic
918747048 1:188216426-188216448 CTGGTAGAATGCGGGGAGGAGGG - Intergenic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
920471339 1:206233287-206233309 CTGGTAAAAGAAGGGAAGGAAGG - Intronic
921536286 1:216352606-216352628 CTAGTAGAAGAAATGGGGGAGGG + Intronic
922417570 1:225435649-225435671 TTGGTAGAACTGAGGGTGGAGGG - Intergenic
924347275 1:243084357-243084379 CTGGTAGAACACAGGGCCAAAGG + Intergenic
924632311 1:245752548-245752570 CTGGAAGAAAAGAGCGAGGAAGG - Intronic
1063001536 10:1928681-1928703 CCATTAGAGCAAAGGGAGGAGGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063680363 10:8181570-8181592 CTGGAAGAATAACGGGAGCATGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1065131183 10:22621933-22621955 CTGAAAGAACAATGAGAGGAAGG + Intronic
1065281574 10:24144319-24144341 CTTGTAGAGCAAAGGGCAGAGGG + Intronic
1065967214 10:30780020-30780042 GTGGTAGAGCAAGGGGAAGATGG + Intergenic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1068302978 10:55169974-55169996 CTGATAGAATAAAGGAAGGAAGG + Intronic
1068518563 10:58053777-58053799 CTGGTAGAATAAAGAGGAGAAGG + Intergenic
1068613285 10:59084571-59084593 ATTATAGAGCAAAGGGAGGATGG - Intergenic
1068674974 10:59761469-59761491 TTGGAAGGACAAAGGGAAGAAGG - Intergenic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1074674322 10:115831106-115831128 CTGGAAGAACAAGGGCAGGTGGG - Intronic
1075731727 10:124640378-124640400 CTGGGATAACAAGGGGAGTAGGG + Intronic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1076030338 10:127152471-127152493 CTGGCAGCAGGAAGGGAGGAGGG - Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1078293465 11:10040556-10040578 CTGGAAGAAAAAAGGGATGGGGG + Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1080135039 11:28844624-28844646 AGGGAAGAAGAAAGGGAGGAAGG - Intergenic
1080449919 11:32370268-32370290 CTGGTATAAGGAAGGAAGGAAGG + Intergenic
1080857037 11:36121324-36121346 ATGGTAGGAAAAGGGGAGGAGGG + Intronic
1081038860 11:38184907-38184929 TAGTTAGAAGAAAGGGAGGAAGG - Intergenic
1083327792 11:61881958-61881980 CTGGTAGAAAAAAGGGCAGAGGG + Intronic
1084196383 11:67525255-67525277 CTGGCAGAACGCAGGGAGGTGGG - Intergenic
1085510261 11:77084555-77084577 CTGGTCAAACAAAGGAAGGCAGG + Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1085973284 11:81620765-81620787 CTTGTAGAGCAAGGGGAGGAGGG + Intergenic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087951910 11:104231254-104231276 TTATTAGAACAAAGAGAGGAAGG + Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089934512 11:122349953-122349975 CTTGCAGAAAAATGGGAGGAAGG - Intergenic
1089960756 11:122615421-122615443 CTGTTAGAAGGAAGGAAGGAAGG + Intergenic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091488145 12:909246-909268 GGGGTAAAAAAAAGGGAGGAGGG - Exonic
1091913610 12:4251577-4251599 TTGAAAGAACAAAGGAAGGAAGG + Intergenic
1093577118 12:20745145-20745167 CCTGTAGAAGAAAGGGAAGAGGG + Intronic
1093601067 12:21023754-21023776 CTTGTAGAACAAATGAATGAAGG + Intronic
1093989373 12:25572811-25572833 CTGGCAGAAGGAAGGGAGGGAGG - Intronic
1094424764 12:30306197-30306219 ATGGTAGAACACAGCAAGGAGGG + Intergenic
1095595183 12:43950825-43950847 CTTGTGGAACAAAGGGAAGATGG + Intronic
1095682146 12:44990185-44990207 TGGGTAGAACAAAGAGAGAAAGG - Intergenic
1096543906 12:52323861-52323883 CTGCTAGCACAAAGTGAGGTGGG - Intergenic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1097560600 12:61200357-61200379 ATGGCAGAACAAAGAGAAGAAGG - Intergenic
1097834240 12:64257423-64257445 CTGGAAGAAGGAAGGGATGAGGG + Intergenic
1098423551 12:70331998-70332020 CTTGTACAAAAAAGGGAGGGAGG + Intronic
1098833397 12:75391000-75391022 CCGGAAGGAGAAAGGGAGGAGGG - Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1099342518 12:81455561-81455583 CTTGGATAATAAAGGGAGGAAGG - Intronic
1099755204 12:86837393-86837415 CTATTAGAACAAAGGAAAGAGGG - Intronic
1099848766 12:88064285-88064307 CTTGCAGAACAAAGGTAGTATGG + Intronic
1100179445 12:92069603-92069625 CTGGTTGAACAAATGAGGGATGG - Intronic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1101084591 12:101222792-101222814 CTGGTAGGGGAAAGGGTGGATGG - Intergenic
1101166114 12:102035621-102035643 CAGGTAGCACAAAGTGAAGAAGG + Intronic
1101787741 12:107900465-107900487 CTGGGAGGATAAAGGAAGGAAGG - Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1104291233 12:127470861-127470883 CTTTTAAAACAAAGGGAGGGGGG - Intergenic
1104710830 12:130984755-130984777 GGGGAAGAAGAAAGGGAGGAAGG - Intronic
1104977520 12:132558876-132558898 CTGGCAGCACACAGGGAGGCCGG - Intronic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107771829 13:43795016-43795038 GTGGAAGAAGAAAGGAAGGAAGG + Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1112547364 13:100383920-100383942 GTGGTAGAACAAAGGAAAAAGGG - Intronic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1113001606 13:105644895-105644917 CTGAAAGAAAAAAGGAAGGAAGG - Intergenic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1113748593 13:112763326-112763348 CTGCTGGTCCAAAGGGAGGAGGG - Intronic
1114196005 14:20476730-20476752 CTGGTAGAAGAAAGTGGGAAAGG - Exonic
1114290671 14:21285868-21285890 CAGGCAGAAATAAGGGAGGATGG + Intergenic
1115350047 14:32384219-32384241 TTGCTAGAATAATGGGAGGAGGG + Intronic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1116188907 14:41637370-41637392 CTATTAGAATCAAGGGAGGAAGG + Intronic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1116918216 14:50545732-50545754 AAGGTAGATAAAAGGGAGGAAGG + Intronic
1117064529 14:51997837-51997859 GGGGTAGAAGAATGGGAGGAGGG - Intronic
1117932818 14:60862911-60862933 GTGGTAGAACAAAGTGTGCAGGG + Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118778478 14:68989686-68989708 ATGATGGAAAAAAGGGAGGAAGG - Intergenic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120791655 14:88589747-88589769 CAGGTGGAACAAGGGAAGGAGGG - Intronic
1121185497 14:91964413-91964435 CTGGCAGACCGATGGGAGGAGGG - Intergenic
1121638346 14:95468712-95468734 CTGGGAGAATATGGGGAGGAAGG - Intronic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124024157 15:25949211-25949233 TGAGTAGAACAAAAGGAGGAAGG + Intergenic
1124026840 15:25974622-25974644 TGGGTAGAACAAAGGGAGGGAGG + Intergenic
1124178952 15:27455282-27455304 CTAGTAGATTAAAGGGCGGAAGG - Intronic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1124322419 15:28725171-28725193 TGAGTAGAACAAAGGGAGGAAGG - Intronic
1125154088 15:36566632-36566654 CTAATAGAATAAAGGAAGGAAGG + Intergenic
1125513019 15:40302933-40302955 CTGGTAGGAAAATTGGAGGAAGG - Intronic
1125936818 15:43644306-43644328 CTTGTGGTAGAAAGGGAGGAGGG - Intronic
1128029460 15:64466938-64466960 CTGCTAGAGCAAGGGGAGGGGGG - Intronic
1128826122 15:70719048-70719070 AGGGTAGAAAGAAGGGAGGAAGG + Intronic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131510093 15:93044998-93045020 CTAGCAGAACACAGGGAGCAGGG + Exonic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133661238 16:7919838-7919860 CTGGCAGAAGGAAGGAAGGAAGG + Intergenic
1133663004 16:7937130-7937152 CAGGAAGGACAAAGGGAGAAAGG + Intergenic
1134881318 16:17747340-17747362 GTGGCACAACAAAGGAAGGAAGG + Intergenic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138215481 16:55201447-55201469 GGGGTAGGAAAAAGGGAGGAAGG - Intergenic
1138629673 16:58283124-58283146 GTGGTAGAATAAAGGCAGGATGG + Exonic
1140227982 16:73094008-73094030 CTGGCAGGGCAAAGGCAGGATGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140917399 16:79506553-79506575 CTGGTAGATAAAAAGGAAGACGG + Intergenic
1141642956 16:85352163-85352185 CTGGTAGACTCAGGGGAGGAGGG - Intergenic
1141678708 16:85531454-85531476 CGGGTAGGAGAGAGGGAGGAAGG + Intergenic
1141819839 16:86437709-86437731 ATGATAGAAGAAAGGAAGGATGG - Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1143067106 17:4258558-4258580 CTGGTAGAAATAAGGAAAGAAGG - Intronic
1143278609 17:5733064-5733086 CTAGTAGGGGAAAGGGAGGAGGG - Intergenic
1143873617 17:9975485-9975507 TGGGTAGAAGGAAGGGAGGAAGG - Intronic
1144390672 17:14790739-14790761 CTGTTAGAGCTCAGGGAGGAAGG + Intergenic
1145907091 17:28522174-28522196 CTATTAGAACAATGAGAGGAAGG - Intronic
1146807738 17:35878640-35878662 CTGGAAGAGGAAAGGAAGGAGGG + Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1148099144 17:45077031-45077053 TAGGAAGAACAAAGGCAGGAAGG + Intronic
1148523616 17:48307405-48307427 CTGGTAGATCCAAGTGTGGAAGG - Intronic
1148808106 17:50274340-50274362 CTGGGAGGAGGAAGGGAGGAAGG - Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149294107 17:55245428-55245450 GTGGAAGAAGAAAGGAAGGAAGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150726627 17:67656282-67656304 CTGGAAGATGAAAGGAAGGATGG - Intronic
1150924441 17:69517833-69517855 ATGGTAGAAGAATGGGTGGAGGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153057022 18:955965-955987 GTGGTGGAAGAAGGGGAGGAAGG - Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153771091 18:8416934-8416956 CTGGTAGAATAAGTGGACGAAGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1154637506 18:16876705-16876727 CTGATTGATCCAAGGGAGGAAGG + Intergenic
1154974970 18:21448523-21448545 ATGGAAGAACAAAGGGGTGATGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156586865 18:38440717-38440739 CTGGTAGAACTGAGACAGGAAGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158930634 18:62322454-62322476 ATGGTAGCACAAAGGGAGGGAGG + Intergenic
1159858298 18:73615583-73615605 CTGGTAGAAGCAATGTAGGAAGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161943783 19:7421914-7421936 CTGGAAGAAGGAAGGGAGAAGGG - Intronic
1162562789 19:11427102-11427124 GTGGGAGAAGGAAGGGAGGAAGG - Intronic
1163041861 19:14608591-14608613 TTGGGAGAAAAAAGGGAGGGTGG + Intronic
1163738671 19:18997292-18997314 CTGGGAGAGGAAAGGGAGAAGGG + Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167361639 19:49033333-49033355 CTGGTAGAAAACAGGGTGGACGG + Intronic
1167362016 19:49035452-49035474 CTGGTAGAAAACAGGGTGGACGG - Intronic
1167364069 19:49045408-49045430 CTGGTAGAAAACAGGGTGGACGG + Intergenic
1167364430 19:49047519-49047541 CTGGTAGAAAACAGGGTGGACGG - Intergenic
1167365715 19:49054154-49054176 CTGGTAGAAAACAGGGTGGACGG - Intergenic
1167795296 19:51704663-51704685 CTCTTAGATCTAAGGGAGGAGGG - Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
925507634 2:4585430-4585452 CTGGTAGGAAAAAGGAAGGAAGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927087045 2:19682573-19682595 TTGGTAGAGCAAAGGGACCATGG - Intergenic
927377573 2:22436102-22436124 GTGTTTGAACAAAGGAAGGAAGG + Intergenic
927532095 2:23815496-23815518 ATGGTACAACAAAGGGGAGATGG + Intronic
927662025 2:25001320-25001342 CTGGTAAAATGAAGGAAGGAAGG - Intergenic
928687068 2:33760709-33760731 CTGCTAGAAAAACGTGAGGAAGG - Intergenic
929406789 2:41651599-41651621 CTGGTGGAATAAAGAGAGGACGG - Intergenic
930094935 2:47559861-47559883 CTGGTAGAAAACAGGGAGGAAGG + Intronic
932634185 2:73373527-73373549 CTGGTAGAACCAAGGATGGGCGG + Intergenic
932947812 2:76257877-76257899 CTGGTAGGAGAAAGTGGGGAAGG + Intergenic
935033549 2:99345642-99345664 CTTGTAGAACATAGGTAGGTGGG + Intronic
935350933 2:102151456-102151478 CTTGTGGAAGAAAGGAAGGAGGG - Intronic
935882578 2:107580425-107580447 CTGGTAGAGCATAGGAAGAAAGG + Intergenic
937460685 2:122083217-122083239 TTGGTAAAGTAAAGGGAGGATGG + Intergenic
938099624 2:128489823-128489845 CTGCCAGGAGAAAGGGAGGAAGG - Intergenic
938940123 2:136162475-136162497 CTGGTAGAAAGAAGGAAGGAAGG + Intergenic
940338892 2:152558610-152558632 CTGAAAGGACATAGGGAGGAAGG - Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941544154 2:166826529-166826551 CTAGGAGAAAAAAGGGAGGTTGG - Intergenic
941592245 2:167434288-167434310 CTTGTAGAACAAATGTGGGATGG - Intergenic
942498637 2:176565063-176565085 CTGGTAGGACATTGGGAGGCAGG - Intergenic
942507030 2:176654026-176654048 TTGGCAGAGCCAAGGGAGGACGG - Intergenic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
945268987 2:207919819-207919841 CTGGCATAACAAGGGAAGGAGGG + Intronic
945400858 2:209380814-209380836 TTGGTAGAACCAAGGGGTGAAGG - Intergenic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
946781872 2:223199806-223199828 TTGGTAGAATAAATGAAGGAAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
1169701471 20:8451803-8451825 ATGGAAGAAAGAAGGGAGGAAGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172454227 20:35054500-35054522 CTGGTAGAAACAAAAGAGGATGG - Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173079613 20:39853123-39853145 CTGGTATAGCAAAGGAAGGAAGG - Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174617403 20:51846518-51846540 TTGGTAGGTCAAAGAGAGGAGGG - Intergenic
1174628400 20:51935108-51935130 CTGGGAGGACAATGGGAAGAGGG + Intergenic
1174990356 20:55502335-55502357 CTGGTTGAAAAAAAGGAGAAAGG + Intergenic
1175459587 20:59142316-59142338 CTGGCAGACCAAAGGAAGTACGG - Intergenic
1175579025 20:60084824-60084846 CTGGAAGAAGATAGGGAGGCAGG - Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1175906964 20:62385510-62385532 AGGGTAGAACAGTGGGAGGAGGG + Intergenic
1176686516 21:9852697-9852719 CTGATTGACCCAAGGGAGGAAGG + Intergenic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1180164512 21:46017027-46017049 CTGGTCTAGCAAAGGGAGGGAGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181098475 22:20522573-20522595 CTTGCAGGAGAAAGGGAGGAGGG + Intronic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182099215 22:27646058-27646080 CTGGGAGAAACTAGGGAGGATGG + Intergenic
1182814345 22:33146317-33146339 TAGGTAGAAGAAAGGGAGAATGG - Intergenic
1182924152 22:34107029-34107051 CTACTAGAACAAAGGGTTGAAGG + Intergenic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184109143 22:42384900-42384922 CTGGTTGGGCCAAGGGAGGAAGG + Exonic
1185095952 22:48806241-48806263 CCGGTAGGACCAAGTGAGGAAGG - Intronic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
949649730 3:6143042-6143064 ATGGTCCAACAAAGGGAGGGAGG + Intergenic
950422701 3:12908078-12908100 CTGGAAGAAGAAAGGGAAAATGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951379447 3:21965838-21965860 ATGGAAGAAAGAAGGGAGGAAGG + Intronic
952020475 3:29012939-29012961 AGGGAAGAAGAAAGGGAGGAAGG + Intergenic
952650434 3:35720241-35720263 TTTGTAAAGCAAAGGGAGGAAGG - Intronic
953471491 3:43170398-43170420 GTAGTAGAACAGAGGGAGGGCGG - Intergenic
954279953 3:49570284-49570306 CCAGTGGAAGAAAGGGAGGAAGG + Intronic
955574927 3:60350624-60350646 TTGGTGGAATACAGGGAGGAAGG - Intronic
958258467 3:91351984-91352006 CCAGCAGAACAAAGGAAGGAGGG - Intergenic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
959893829 3:111584876-111584898 CTGGTAGTGCAAGCGGAGGATGG - Intronic
959925201 3:111913299-111913321 CTCCTGGAACACAGGGAGGAGGG - Exonic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962890357 3:139666712-139666734 CTGGTACAGTAAAGGGAGGTTGG - Intronic
963229839 3:142898489-142898511 CTTGTGGAAGAAAGGGAGGGAGG - Intergenic
963654266 3:148025222-148025244 GAGATAGACCAAAGGGAGGAGGG + Intergenic
965487770 3:169299388-169299410 CTGGTAGAATCAGGTGAGGAAGG - Intronic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
969228813 4:5815858-5815880 CTGGTGGAAGGAAGGGAGGGAGG + Intronic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
973178374 4:47236683-47236705 CAGGTAAAACAAAGGCAGAAAGG + Intronic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973953753 4:56042479-56042501 ATGGAAGAAGAAAGGAAGGAAGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
975277934 4:72524245-72524267 CAGGTAGGAGAAAGGTAGGAAGG + Intronic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976472670 4:85447814-85447836 CTGCCAGGAGAAAGGGAGGAAGG + Intergenic
977086696 4:92608100-92608122 CTGATAGAAAAATGGGAGGTAGG + Intronic
978346734 4:107777913-107777935 ATGGAAGAAGGAAGGGAGGAAGG + Intergenic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
979490412 4:121320323-121320345 CTAGCAGATCAGAGGGAGGAAGG + Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
983940903 4:173533137-173533159 GTGGGAGAAGAAAGGGAGAAAGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985932455 5:3069169-3069191 CAGGCAGAACCAAGGGAGGGAGG - Intergenic
986787790 5:11130807-11130829 TTGGTAGAATACAGGGAGGGCGG - Intronic
987377384 5:17248872-17248894 GTGGTGGTACAAAGGGAAGAAGG - Intronic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
989264901 5:39462217-39462239 CAGGAAGTACCAAGGGAGGATGG - Intronic
990601195 5:57360200-57360222 CTGTTATAGCAAAGAGAGGATGG + Intergenic
990916953 5:60917355-60917377 CTGGTAGAACATAGGATTGAAGG + Intronic
991005413 5:61823527-61823549 TAGGAAGAACAAAGGTAGGAAGG + Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
993542611 5:89171309-89171331 GTGGTAGACAAAAGGGAAGAGGG + Intergenic
993738502 5:91507224-91507246 CTGGTAGAACCAAAGGAAGAAGG + Intergenic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997713661 5:136027059-136027081 CTGGTAGAAAGAAGGTGGGAAGG - Intergenic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
999405020 5:151299173-151299195 TTGGTTGAACAAATGGATGAAGG - Intronic
999866401 5:155705103-155705125 GTGGAAGAAGAAAGGGAGAATGG - Intergenic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000445582 5:161314710-161314732 GGGAAAGAACAAAGGGAGGAAGG - Intronic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001711303 5:173780559-173780581 TTTGGAGAACAAAAGGAGGAAGG - Intergenic
1002543981 5:179926126-179926148 GAGGTAGAACAAAGACAGGATGG - Intronic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1003140420 6:3466947-3466969 CTGATAGAACAAAGAAAGCAGGG + Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1007422605 6:41728666-41728688 CTGGTAGAACTCGGGGAGGGGGG + Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1012817227 6:104039442-104039464 CTACTAGATAAAAGGGAGGAGGG + Intergenic
1012953877 6:105547884-105547906 GAGGTAGAAAAAAGGGAGGAAGG + Intergenic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1014215386 6:118747956-118747978 CTGTTAGAGCAAAGGAAGGTAGG - Intergenic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017042189 6:150316476-150316498 CTGGAAGAGAAAAGTGAGGAGGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017120637 6:151020905-151020927 CTGGAAGAACGTATGGAGGAGGG - Intronic
1017531625 6:155297955-155297977 CTCTCAGAACAAACGGAGGAGGG - Intronic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1021983505 7:26077532-26077554 CAGGAAGAAGAAAGGAAGGAAGG + Intergenic
1022073374 7:26940179-26940201 CAGGTAGAAGGAAGGGAGAAAGG - Intronic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1028858680 7:95622212-95622234 TTGGTAGAAGAAGGGAAGGAGGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1031614389 7:123864161-123864183 CTAGTAGAAGGAAGTGAGGAAGG - Intronic
1031982853 7:128139970-128139992 GTGGTAGAAGAGAGGGAGAAGGG - Intergenic
1032094335 7:128930042-128930064 CTGGCAGGACAATTGGAGGATGG + Intergenic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1033828426 7:145221403-145221425 CTGGTATCACAAATGAAGGAAGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1036016605 8:4792099-4792121 CTGTTAGAAAATACGGAGGAAGG - Intronic
1037109771 8:15152238-15152260 CTGGAAGAACAAAGCAAGGCAGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1037620712 8:20561184-20561206 CTTTTAGAAGGAAGGGAGGAAGG + Intergenic
1037893221 8:22635124-22635146 CAGGTAGAGCCAAGGGAAGAGGG - Intronic
1038283977 8:26190471-26190493 CGGGTAGAGCAGCGGGAGGAGGG - Intergenic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1041411711 8:57563507-57563529 AGGGTAGAAAAAAGGAAGGAAGG + Intergenic
1044083994 8:87921155-87921177 CAGATAGAACAAAAAGAGGAAGG + Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045315072 8:101036833-101036855 ATTGTAGAAAAAGGGGAGGATGG - Intergenic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045366891 8:101484822-101484844 CTGGAAGAAGGAAGGGAGGAAGG - Intergenic
1045593834 8:103629899-103629921 CTGGCAGTACAAAGGAAGGCAGG + Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1047960897 8:130010997-130011019 GTGGTAGAAGCAAGGGAGGGAGG - Intronic
1048041614 8:130734776-130734798 TTGCTAGAACAAAGGATGGAGGG + Intergenic
1048043899 8:130755555-130755577 CTGGAAGAGGACAGGGAGGAGGG - Intergenic
1048232177 8:132653218-132653240 ATGGAAGAAGGAAGGGAGGAAGG + Intronic
1048563963 8:135574248-135574270 CTGGTGGAAGAAAGGCATGATGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1050045077 9:1534380-1534402 CTGATAGAGCAAAGAGGGGAAGG + Intergenic
1050101277 9:2122738-2122760 ATGGTAGAACCAAAGGAAGAAGG + Intronic
1050188051 9:2996033-2996055 CAGGTAGAAAAATGAGAGGAGGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1052480066 9:29012506-29012528 CTGATAGAACCAAGTGAGAACGG - Intergenic
1052972093 9:34382813-34382835 CTGGTACAACACATGGAGGATGG - Exonic
1053453982 9:38216926-38216948 CTGTTAGAACAAAAGTAGTAAGG + Intergenic
1053599316 9:39594053-39594075 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1053782804 9:41628895-41628917 CTGATTGATCCAAGGGAGGAAGG - Intergenic
1053857021 9:42348239-42348261 AGGGTGGAAGAAAGGGAGGAAGG - Intergenic
1054170755 9:61839035-61839057 CTGATTGATCCAAGGGAGGAAGG - Intergenic
1054254208 9:62748333-62748355 AGGGTGGAAGAAAGGGAGGAAGG + Intergenic
1054666781 9:67741772-67741794 CTGATTGATCCAAGGGAGGAAGG + Intergenic
1055739222 9:79367609-79367631 CTAGTAGGAAAAAGGAAGGAGGG + Intergenic
1057825907 9:98371923-98371945 CAGGAAGAAGGAAGGGAGGAGGG - Intronic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058834835 9:108851832-108851854 CTGGTATAGAAAAAGGAGGAGGG - Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059077278 9:111206843-111206865 GGGGTAGAAAAAAGGAAGGAGGG + Intergenic
1059587574 9:115622234-115622256 CTGGCAGGCCAAAGAGAGGATGG + Intergenic
1061738872 9:132684572-132684594 GCGGGAGGACAAAGGGAGGAAGG - Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061822013 9:133234225-133234247 CTGTTAGAAAAAAGACAGGAAGG - Intergenic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062237283 9:135516288-135516310 CTGTTAGAAAAAAGACAGGAAGG + Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1186107134 X:6219604-6219626 ATGGAGGAACGAAGGGAGGAAGG - Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187387366 X:18860928-18860950 CTGGTAGAACAGAGGGTTGGGGG - Intergenic
1187627830 X:21136114-21136136 CTGGTAGAAAAAATGGACTATGG - Intergenic
1187939285 X:24365377-24365399 TTGGTAGATCAGAGGAAGGAAGG + Intergenic
1190367777 X:49713130-49713152 TTAGTAGGAGAAAGGGAGGAGGG + Intergenic
1192579175 X:72266769-72266791 TTGGGAGAAAAAAGGGAGGGTGG - Intronic
1193662918 X:84279004-84279026 CTGGTAGTTCAGAGGAAGGAGGG - Intergenic
1194898933 X:99482843-99482865 CTGGTAATACCAAGGGAGGATGG - Intergenic
1198035963 X:132801597-132801619 CTTGTTGGACCAAGGGAGGAAGG - Intronic
1198215355 X:134549897-134549919 CGGGGAGAAAAAACGGAGGATGG + Intergenic
1198518748 X:137431762-137431784 AAGGAAGAACAAAGGAAGGAAGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic