ID: 1040436025

View in Genome Browser
Species Human (GRCh38)
Location 8:47392321-47392343
Sequence TAGGCTACTACCACTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040436016_1040436025 25 Left 1040436016 8:47392273-47392295 CCACAACAGTGTTCGAGTCAGAC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1040436025 8:47392321-47392343 TAGGCTACTACCACTCCAAGTGG No data
1040436021_1040436025 1 Left 1040436021 8:47392297-47392319 CCACCTTTATGGGGAAGGACCTT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1040436025 8:47392321-47392343 TAGGCTACTACCACTCCAAGTGG No data
1040436022_1040436025 -2 Left 1040436022 8:47392300-47392322 CCTTTATGGGGAAGGACCTTCTA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1040436025 8:47392321-47392343 TAGGCTACTACCACTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040436025 Original CRISPR TAGGCTACTACCACTCCAAG TGG Intronic
No off target data available for this crispr