ID: 1040436089

View in Genome Browser
Species Human (GRCh38)
Location 8:47393145-47393167
Sequence TGGGATACCTGGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040436089 Original CRISPR TGGGATACCTGGGGAAAAAC TGG (reversed) Intronic
901722249 1:11208719-11208741 TGGCATACATGGTGAAAAGCTGG + Intronic
904405817 1:30287293-30287315 GGGGGTACTTGGGGAAACACTGG + Intergenic
905334425 1:37234505-37234527 TGAGATACTTGGGGAAGAGCTGG - Intergenic
905804439 1:40865560-40865582 TGGGGTATCTGGGGCAAAAGCGG + Intergenic
907492156 1:54815104-54815126 TCGGTTACCTGGGGACAAAGAGG - Intronic
907702760 1:56805343-56805365 TAGGGTAACTGGGGAAAAATTGG + Intronic
907969189 1:59364131-59364153 TGGGACACCTGAGGATAACCTGG - Intronic
911034904 1:93532040-93532062 GGGGATACGTGAGGAAAAACAGG - Intronic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911852295 1:102835237-102835259 TGTTATAACTGTGGAAAAACTGG + Intergenic
912421906 1:109548357-109548379 TTGGATAAATGGAGAAAAACCGG - Intronic
916369606 1:164075802-164075824 AGGGATATCTGGGGAAAACCTGG - Intergenic
916531946 1:165664899-165664921 TGAATTACCTGGGGAAATACAGG - Intronic
917513693 1:175689314-175689336 TGGTATCCCTGTGGAAAGACGGG - Intronic
918282193 1:183018068-183018090 TTGGATGCATGGGTAAAAACAGG + Intergenic
919725539 1:200880360-200880382 TGAGAGAGCTGGGGAAAGACGGG + Intergenic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
920412127 1:205770566-205770588 TGAGATAACTGGGGACAAAGGGG - Intronic
920969438 1:210730582-210730604 AGGGTTACATGGGGAAAAGCTGG - Intronic
921076946 1:211707459-211707481 TGGGGTACCTGGGTAAAGAATGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921950637 1:220926492-220926514 TGGGATAACTGTGGCAAACCAGG + Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
922452120 1:225745884-225745906 TGGGTTACTTGGGGAATAATCGG + Intergenic
923167880 1:231384563-231384585 TGGCATATCTGAGGAAAAAGAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1064716213 10:18179389-18179411 TGGGATGCAGGGAGAAAAACAGG - Intronic
1065886786 10:30085235-30085257 TGGGACATCAGGGGAAAAGCAGG + Intronic
1066793020 10:39087028-39087050 TGAGGTCCATGGGGAAAAACAGG + Intergenic
1069996352 10:72344391-72344413 TGGGAGACCTGGGGAGAAATGGG + Intronic
1070251380 10:74776437-74776459 TGGGGTACCTGGGTAAAGAATGG + Intergenic
1070648999 10:78221607-78221629 TGATAAACCTGGGGACAAACAGG - Intergenic
1070820795 10:79352998-79353020 TGGGGCACCTGGGGATGAACTGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071392530 10:85190103-85190125 TGGGGTACCTGGGTAAAGAATGG - Intergenic
1074454472 10:113585545-113585567 TGGCCTACCTGGGGAAAGAGAGG + Intronic
1075005569 10:118827502-118827524 TGGGATACCTGGGGCTCAGCTGG + Intergenic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1075953684 10:126504483-126504505 TGGGGTGTCTGGAGAAAAACTGG + Exonic
1076317770 10:129554939-129554961 TGTGATACCTGGGGAAACTGAGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080523666 11:33091253-33091275 GTGGATCACTGGGGAAAAACTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081778004 11:45689645-45689667 GGGAACACCTGGGGTAAAACAGG + Intergenic
1081868473 11:46372442-46372464 TGAGATACCAGAGGAAAGACTGG - Exonic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083391829 11:62357049-62357071 AGAGATTCCTGGAGAAAAACTGG + Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1090495432 11:127206678-127206700 TGTGCTTCCTGGGGAAACACAGG - Intergenic
1090918370 11:131186784-131186806 AGGGAAACCTGGTGACAAACAGG + Intergenic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1092917850 12:13204220-13204242 TGGGAAACATGGGGAGAAAAAGG - Intronic
1093500005 12:19800971-19800993 TAGAATACCTAGGGTAAAACCGG - Intergenic
1093558484 12:20508168-20508190 GGGGATAACTGGGGACAAAGTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095799518 12:46257487-46257509 TGGGGTACCTGGGTAAAGAATGG - Intronic
1097180235 12:57167649-57167671 TGGGTTGCCTGGGAGAAAACAGG + Intronic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1099273614 12:80546997-80547019 TGAGACAGCTGGGGAAAAAGGGG + Intronic
1100494775 12:95114264-95114286 TGTCATAACTGGGGAAAAGCGGG + Intronic
1100959296 12:99944820-99944842 AGGGATTGCTAGGGAAAAACTGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101989117 12:109469928-109469950 TGGGCTAGCAGGGGAACAACTGG + Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1105202486 13:18192148-18192170 TGGGATTCCAGAGGAACAACAGG - Intergenic
1105590582 13:21789701-21789723 TGGAATAGCAGGGGAAAGACCGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107651780 13:42552368-42552390 TGGCCTCCCTGGGGAAAGACTGG + Intergenic
1107787259 13:43969365-43969387 TGAGATACCAGAGGAAAGACTGG - Intergenic
1107816985 13:44253306-44253328 TGGGCCAACTGGGGGAAAACAGG + Intergenic
1111310966 13:86485158-86485180 TTGGATAACTGGGGAAAAAATGG - Intergenic
1111568070 13:90042612-90042634 TGGGGTAACTGGGTAAAAAAGGG + Intergenic
1112517640 13:100068709-100068731 TGGTAAGCCTGGGGAGAAACAGG + Intergenic
1112534910 13:100243440-100243462 AGAGATACCTGGGGAAAAAAAGG + Intronic
1112647401 13:101350262-101350284 TGGGATACTTGGGGGAAAGGGGG - Intronic
1112906746 13:104431767-104431789 TGGCATGGCTGGGGAAAAAGAGG + Intergenic
1113313875 13:109158254-109158276 TGGGAGAGCTGGAGAAAGACAGG - Intronic
1113887004 13:113666292-113666314 TGGGACAGCTGGGGAACACCTGG - Intergenic
1115775437 14:36709738-36709760 GGGGATAGCTGGGCAAAAACAGG + Intronic
1116671218 14:47845770-47845792 AAGGATCCCTGGGGAAAACCTGG - Intergenic
1118858910 14:69646530-69646552 TGGGGTACCTGAGGGATAACTGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119912312 14:78360906-78360928 TGGGGTACCTGAGGAAAAAGTGG - Intronic
1120541405 14:85755331-85755353 TGGGATATGTGGGGAAAGAAGGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1123046615 14:105520663-105520685 TGGGAAAACTGGGGAGAAATTGG + Intergenic
1124071932 15:26403536-26403558 TGGGCTATTTGGGGCAAAACTGG - Intergenic
1127260005 15:57320549-57320571 TGTGATACAAGGGGAAAAAAAGG + Intergenic
1127741870 15:61915909-61915931 TGAAATACCAGGGCAAAAACTGG - Exonic
1128079927 15:64850909-64850931 TGAAATACCTGGGGAAGAATTGG + Intronic
1131114259 15:89784434-89784456 TGGGATACCTGGGACAATGCGGG - Intergenic
1131779225 15:95838120-95838142 TAGGATAAGTAGGGAAAAACAGG + Intergenic
1134818679 16:17227927-17227949 TGGGCAACTTGGGGAATAACAGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139372117 16:66475441-66475463 AGGGATCCCTGGGGAAAGTCAGG - Intronic
1140017942 16:71206170-71206192 TGTGCTTCCTGGGGAAACACAGG - Intronic
1144481326 17:15631800-15631822 TGGGCTTCCTGGGGAAAGAAGGG + Intronic
1144916979 17:18731931-18731953 TGGGCTTCCTGGGGAAAGAAGGG - Intronic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150458402 17:65326885-65326907 TAGGGTCCCTGGGGAGAAACTGG + Intergenic
1150484243 17:65532944-65532966 TGGGAAACCTGGGACAGAACTGG + Intronic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1153488443 18:5625537-5625559 TGAGATGACTGGGGAATAACTGG + Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155850691 18:30770113-30770135 TGGGGTACCTGGGAAAAGAATGG + Intergenic
1156197670 18:34793939-34793961 TGAGATACCTAGAAAAAAACAGG + Intronic
1156557667 18:38085849-38085871 AGAGATACCTGGGGAAGAAGAGG + Intergenic
1157309649 18:46542746-46542768 TGGGAGACCTGTGGAAAGTCCGG - Exonic
1158863379 18:61614939-61614961 TGTGATACCTGGGCAGAGACTGG - Intergenic
1160352398 18:78194777-78194799 AGGGACAGCTGGGGAAAGACTGG + Intergenic
1163954152 19:20619418-20619440 TGGGATAGCTTAAGAAAAACAGG - Intronic
1164383452 19:27754280-27754302 AGAGACACCTGGGTAAAAACAGG - Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167991744 19:53366236-53366258 TGGGAGACCTGGGGAGCAGCAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925560598 2:5189795-5189817 AGGGCAACTTGGGGAAAAACTGG - Intergenic
927311553 2:21637487-21637509 TGGGATCCATGGGCTAAAACAGG - Intergenic
927483590 2:23473321-23473343 TGGGAGAGGTGGGGAAGAACAGG + Intronic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
928672291 2:33613998-33614020 TGGGCTGCCTGGGGAAAAACAGG + Intergenic
930899333 2:56484558-56484580 TGGGGTCCCCCGGGAAAAACTGG - Intergenic
931034926 2:58229464-58229486 TGGGATATCTGTGGCAAAAATGG - Intronic
932912874 2:75822608-75822630 TGTGCTTCCTGGGGAAACACAGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933581893 2:84136452-84136474 TGTGATGGCTGGAGAAAAACTGG - Intergenic
936016056 2:108959810-108959832 TGAGAGACCTGTGGAAAAGCTGG - Intronic
937498656 2:122453061-122453083 TGGGATAACTGGTGAACCACAGG + Intergenic
941122691 2:161549482-161549504 TGGGAAAGCTGGGAAAAAAAAGG - Intronic
941267169 2:163377011-163377033 TGGCAAACCTGGGGAAAATCAGG + Intergenic
941367449 2:164624484-164624506 TGGGATTCCTGAGGAAAGACAGG - Intergenic
941486290 2:166086423-166086445 TGGGATCCATGTGGAAAAAATGG - Intronic
941566577 2:167115759-167115781 TGTGCTTCCTGGGGAAACACAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942600168 2:177632934-177632956 TGGGGAGCCTGGGAAAAAACTGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
947633061 2:231666123-231666145 TGGGCTCCCAGGGGAAACACTGG + Intergenic
1170714450 20:18819847-18819869 TGGGATCTCTGGGGGCAAACTGG - Intronic
1170987092 20:21268469-21268491 TGGGACAGCTGGGGAAGAGCAGG - Intergenic
1174227123 20:49010217-49010239 TGGGAGACCTGAGGAAAGAATGG - Exonic
1174780621 20:53385645-53385667 TGGGAACCCTGGGTTAAAACTGG - Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1176715464 21:10345862-10345884 TGGGATTCCAGAGGAACAACAGG + Intergenic
1177381007 21:20344264-20344286 TGAGATACATGGTGAAAAGCAGG + Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178689780 21:34741339-34741361 TGGGAGACCTGGAGGAAACCAGG + Intergenic
1179022472 21:37652680-37652702 TGGGATAACTTTGGACAAACTGG + Intronic
1179244402 21:39618426-39618448 TGGGGAAGCTGTGGAAAAACAGG - Intronic
1179910126 21:44443063-44443085 GGGGATACCTGGGGACAAGGGGG - Exonic
1180602884 22:17034091-17034113 TGGGATTCCAGAGGAACAACAGG - Intergenic
1182959629 22:34460078-34460100 TGGAATTCCTGGGGGAAAAGAGG - Intergenic
952629892 3:35453541-35453563 TGTGCTTCCTGGGGAAACACGGG - Intergenic
952972296 3:38659219-38659241 TGGGGTCCCTGGGGAAAGTCTGG + Intergenic
955389070 3:58506246-58506268 TAGAATAATTGGGGAAAAACAGG + Intronic
956515740 3:70045795-70045817 TGTGTTACCTTGGGAAAATCTGG + Intergenic
956796338 3:72722111-72722133 TTGGATACCTGGGGCCCAACAGG + Intergenic
957153360 3:76515391-76515413 TGTGATAGTTGGGGAAAAAAAGG - Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
960093411 3:113665104-113665126 GGTGATACCTGAGCAAAAACTGG + Intronic
960594436 3:119395424-119395446 TGGGACAGCTGGGGAAAACATGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962674365 3:137743520-137743542 GTAGATGCCTGGGGAAAAACTGG + Intergenic
967220327 3:187242899-187242921 TGGGCTACCTGGGGAGACAGAGG + Intronic
969420388 4:7090932-7090954 TGGGGTACCTGGGTAAACAATGG - Intergenic
970862842 4:20723323-20723345 TGGCATACCTGGCACAAAACAGG - Intronic
971239900 4:24878969-24878991 TGAGATACCTGGTAGAAAACAGG + Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972342681 4:38166080-38166102 TGGGCTTCCTGGGGAAAGGCAGG - Intergenic
973106340 4:46343155-46343177 TGGAAAAAGTGGGGAAAAACAGG - Intronic
974009640 4:56594987-56595009 TGGGATGATTGGGCAAAAACGGG - Intronic
975769597 4:77707101-77707123 TGGGAGACCTGGAGGGAAACTGG + Intergenic
976955717 4:90896672-90896694 TGGGAGCACTGGTGAAAAACTGG + Intronic
980988096 4:139715209-139715231 TGGGGTACCTGGGTAAAGAATGG - Intronic
982897776 4:160955929-160955951 TGCAATACCAGGTGAAAAACTGG + Intergenic
985791043 5:1926856-1926878 TGGGAGAACTGGGGGAGAACCGG - Intergenic
988835314 5:35026572-35026594 TTAGAAACATGGGGAAAAACAGG + Intronic
989690292 5:44135411-44135433 TGGGATCTCTGGGGAAAGAGTGG - Intergenic
991928212 5:71726053-71726075 CAAGATACCTGGGGAAAAAAAGG - Intergenic
992438974 5:76781536-76781558 TGGGGTACCTGGGTGAAAAATGG + Intergenic
993548271 5:89240608-89240630 TGGGTTACATGGAGAAAAAGGGG + Intergenic
995890148 5:116942022-116942044 CGGACTACCTGGGGAAAAAGAGG - Intergenic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
996651293 5:125880039-125880061 TGGGATACCTGGGGAATATTGGG - Intergenic
996706878 5:126506797-126506819 TGGGACAGCTGGGGAAGCACAGG - Intergenic
999400408 5:151259740-151259762 TGGGATGGCTGGGGACAATCAGG - Exonic
1001975815 5:175997499-175997521 TGGGGCACCTGGGGAGAATCAGG - Intronic
1003071255 6:2947255-2947277 TGGGAGAGCTGGGGAAAGAAGGG - Intergenic
1005637925 6:27768796-27768818 TGGGAAACCTGGTGAAAAGTTGG + Intergenic
1005765975 6:29012471-29012493 TGGCAAAGCTGGGGAAAAACAGG - Intergenic
1006188051 6:32191614-32191636 TGGGGTGCCTAGGGAGAAACAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010583811 6:77632916-77632938 TATGATAGCTGAGGAAAAACAGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012359698 6:98361805-98361827 AGGGAGACATGGGGAAAGACTGG + Intergenic
1012969100 6:105707554-105707576 TAAGATAGCTGGAGAAAAACTGG - Intergenic
1013010394 6:106115116-106115138 TGGCATACTTGGGGAAGCACGGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015378403 6:132536655-132536677 TAGGAGACCTGGGGAAGAAGAGG + Intergenic
1015444323 6:133285882-133285904 TAGGATGACTGGGGAAGAACAGG + Intronic
1015856170 6:137626791-137626813 TGGGGAAGCTGGGGACAAACTGG - Intergenic
1016043535 6:139457791-139457813 TGGGGAACCTGGGGAAAGACTGG + Intergenic
1016919427 6:149276671-149276693 TGGCATAGCTGTGGAAAAATAGG + Intronic
1017556774 6:155580131-155580153 TGGAATCCCTGAGGACAAACTGG + Intergenic
1017788383 6:157774611-157774633 TGGCATACTTGGGGGAAAGCTGG + Intronic
1018494663 6:164337384-164337406 TGGGCTCCCTGGGGAGATACAGG - Intergenic
1019572489 7:1719523-1719545 TGGGAGGCTTGGGGAACAACAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020426403 7:8071059-8071081 TGGGATTCCGGGGGACAAAAAGG - Exonic
1021913007 7:25405222-25405244 TCTGACACCTGGGGAAACACTGG - Intergenic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1025223346 7:57135146-57135168 TGGCATACCTGGGTAAAGAATGG + Intronic
1026937982 7:74270017-74270039 TGGGAGGCCTGGGCATAAACAGG - Intergenic
1029596212 7:101538776-101538798 TGGGATCCCTGGGGACAAAGTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030842433 7:114372445-114372467 TGGGAAAACTGGGGAAAGAACGG + Intronic
1031856153 7:126924944-126924966 TGTGAGACCAGGAGAAAAACAGG + Intronic
1032428006 7:131837448-131837470 GGGAAAAACTGGGGAAAAACTGG + Intergenic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1033322151 7:140349605-140349627 AGTGATACCTAGGGAATAACTGG - Intronic
1036041805 8:5092294-5092316 TTGGAAACCTGGGAAAGAACTGG + Intergenic
1036468951 8:9032733-9032755 TTGGAGACCAGGAGAAAAACTGG + Exonic
1036998620 8:13689836-13689858 AGAGATACCCTGGGAAAAACTGG - Intergenic
1038500163 8:28037186-28037208 TGTAATGCTTGGGGAAAAACTGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1041176736 8:55204548-55204570 TGGGCTACGTGGGTATAAACTGG - Intronic
1041755024 8:61304357-61304379 TGGGCTACCTGAGCATAAACTGG + Intronic
1042740505 8:72039082-72039104 TAAGATACCTGGGGAAAAAATGG + Intronic
1045679610 8:104644631-104644653 TGGCATTCATGGGGAAAGACCGG - Intronic
1045849065 8:106672088-106672110 TCAGATATGTGGGGAAAAACCGG + Intronic
1048430899 8:134369639-134369661 TGGGGTCCTTGGGGTAAAACAGG - Intergenic
1048977195 8:139679755-139679777 AGGGAAACCTGGGGAAACACAGG + Intronic
1050036127 9:1437968-1437990 TGGAATAGGAGGGGAAAAACTGG + Intergenic
1051405244 9:16730072-16730094 TAGGATACCTGGGAAAGAAGAGG - Intronic
1052443551 9:28529760-28529782 TGGTAAACCTGGGAAAGAACTGG - Intronic
1052982922 9:34461913-34461935 TGGGATCCCTGGGGATGAAGGGG + Intronic
1053473982 9:38368675-38368697 TGGGATACCAGTGCAAAAAGAGG - Intergenic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058740347 9:107936563-107936585 AGGGAGACCAGGGGAATAACCGG - Intergenic
1059548604 9:115204486-115204508 TGGAATACTTAGGGAAATACAGG + Intronic
1061395481 9:130341388-130341410 TGGGAGAGCTGGGGAGAAGCAGG - Intronic
1187243121 X:17531276-17531298 TGGGGCACCAGGGGAAGAACTGG - Intronic
1189915148 X:45849541-45849563 GGGGACATCTGGGGAAAAAGTGG + Intergenic
1190119997 X:47651424-47651446 TGGGGTACCTGGGGAATGATTGG + Intergenic
1190789460 X:53685674-53685696 TGGCATAACTGTGGAAAAATAGG + Intronic
1190911081 X:54773369-54773391 TGAGCAACCTGGGGAAAAATGGG - Intronic
1191274913 X:58532914-58532936 TGGGATATCTTCAGAAAAACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191823357 X:65337153-65337175 TGGGGTACCTGGGTAAAGAATGG - Intergenic
1191856761 X:65633532-65633554 TGAGAGGCCTGGGGAAATACAGG - Intronic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1196518591 X:116644207-116644229 AGGGATACCTGGGGAATAATAGG - Intergenic
1196627203 X:117890045-117890067 TGAGATAGTTGGGGAATAACCGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199967576 X:152832592-152832614 AGGGTTACCAGGGGCAAAACTGG - Intronic
1200414737 Y:2897657-2897679 TAGCATACATGGGGCAAAACAGG - Intronic