ID: 1040443956

View in Genome Browser
Species Human (GRCh38)
Location 8:47474458-47474480
Sequence GGAGTGAGATGTTGTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443956_1040443967 24 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443956_1040443963 11 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443963 8:47474492-47474514 CTGAGTGTTGGTTCTCTTTCTGG No data
1040443956_1040443966 23 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG No data
1040443956_1040443965 15 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443965 8:47474496-47474518 GTGTTGGTTCTCTTTCTGGTGGG No data
1040443956_1040443962 -1 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443962 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG No data
1040443956_1040443964 14 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443964 8:47474495-47474517 AGTGTTGGTTCTCTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443956 Original CRISPR GGAGTGAGATGTTGTGACTG GGG (reversed) Intronic
900907574 1:5571614-5571636 GGAGTCAGCTGTTTTGACTTAGG - Intergenic
901306748 1:8238591-8238613 GGAGTGAGATGTTTTGAGACAGG - Intergenic
901514018 1:9733199-9733221 GGAGTGACAAGTTGTGTTTGGGG - Intronic
902054512 1:13589091-13589113 GGTGTCATATGTGGTGACTGGGG + Intronic
902264206 1:15249750-15249772 GGAGGGAGAGGTTGTCACTTGGG - Intronic
903340083 1:22648264-22648286 GGAGAGAGATGTTCTAAGTGTGG + Intergenic
903745682 1:25585080-25585102 GGTGTGGGGTGTTGAGACTGAGG + Intergenic
905341529 1:37281710-37281732 GGAGTGATGTGATGTGACTTAGG - Intergenic
905645419 1:39622022-39622044 GGAGTGATGTGGGGTGACTGGGG - Intergenic
905730999 1:40299604-40299626 GGACTGAGATGCTGTAACTTGGG + Intergenic
906170581 1:43721650-43721672 GGAGTGCGATGGTGTGACCTCGG + Intronic
906266864 1:44438169-44438191 GGAGTGCAGTGTTGTGATTGTGG + Intronic
907519020 1:55011187-55011209 GGAGTGAGATGGTGAGACCCAGG + Intergenic
909380867 1:74996946-74996968 TGAGTGGGATGTTGTGGCTATGG - Intergenic
910767948 1:90801293-90801315 GGTGTGGGATGTTGAGAATGGGG - Intergenic
912947462 1:114096871-114096893 GGTATGAGATATTGTGAGTGAGG + Intronic
914830553 1:151167779-151167801 GGAGTGAAGTGGTGTGACCGTGG - Intronic
916814764 1:168340945-168340967 GGAGCCTGATGTTGTGACTCAGG + Intergenic
916911980 1:169360580-169360602 GGAGGGAGATAGTGTGGCTGGGG - Intronic
918619001 1:186581184-186581206 GGAGAGAGATGTAGTAACCGTGG - Intergenic
918844468 1:189591796-189591818 GGAGTGTAATGTTGTGACTTCGG - Intergenic
919913214 1:202124596-202124618 GGAGTGTAATGGAGTGACTGTGG + Intronic
920129857 1:203723786-203723808 GGAGTGGGATGATGTGGCTTTGG + Intronic
920132837 1:203745832-203745854 GGAGTGCAATGGTGTGACTTCGG - Intergenic
920607417 1:207402330-207402352 GGAGTGCGATGTTGCGATTTCGG + Intergenic
922898324 1:229117659-229117681 GGCATGAGTTGTTGTGACAGAGG - Intergenic
923197583 1:231683474-231683496 GGAGTGCAATGGCGTGACTGTGG + Intronic
923801627 1:237215385-237215407 GGATTAAGATGTTGTAAATGAGG + Intronic
924183986 1:241467425-241467447 AGAGAGAGAAGTTGTGACTTTGG + Intergenic
924460677 1:244255778-244255800 GGAGTGCAGTGTTGTGATTGTGG - Intergenic
1063788664 10:9414260-9414282 GGAGTCACTTGTTATGACTGAGG + Intergenic
1063879349 10:10515035-10515057 GGACTGAAATGTTTTGCCTGTGG + Intergenic
1067365379 10:45623059-45623081 GGTGTGAGGTGATGTCACTGTGG - Intronic
1067799227 10:49347558-49347580 TCAGTGAGAGGTGGTGACTGGGG - Intergenic
1069091580 10:64205443-64205465 AGAGCCAGATGTCGTGACTGAGG - Intergenic
1069306795 10:66980955-66980977 GGAGTGCGATGGTGTGATTTCGG + Intronic
1070302517 10:75214573-75214595 GGAGTGCAATGGTGTGATTGTGG + Intronic
1071049038 10:81423384-81423406 GGAGTGACATGATCTGACTTAGG + Intergenic
1074023012 10:109604195-109604217 GAAGTCAGAGGTTGTGACTCAGG + Intergenic
1075677107 10:124303430-124303452 AGAGTGGGATGTTAGGACTGGGG - Intergenic
1078208639 11:9252243-9252265 GGAGTGCAGTGGTGTGACTGCGG - Intronic
1080110166 11:28557629-28557651 GGAGTGATATGATGTGACTTGGG - Intergenic
1082920002 11:58482581-58482603 GGAGAGAGATGATATCACTGGGG - Intergenic
1083374718 11:62210137-62210159 GAAATGAGGTGTTCTGACTGGGG - Intronic
1083729325 11:64644392-64644414 GGAGGGAGAGGTTGGGGCTGGGG - Intronic
1087339441 11:96884305-96884327 GGGGTGAGATGATGGGGCTGGGG + Intergenic
1088453894 11:110013563-110013585 GGAGTGCAATGTTGTGATTTTGG - Intergenic
1088487304 11:110353024-110353046 GGAGTGTGATGGTGTGAATTTGG - Intergenic
1089295574 11:117465247-117465269 GGAGTGACATGATCTGACTTTGG - Intronic
1089968119 11:122670811-122670833 GGAGTGCAATGGTGCGACTGTGG + Intronic
1090757010 11:129801503-129801525 GGAGTGCGATGGTGTGACCTTGG - Intergenic
1091030633 11:132184393-132184415 GGTGTGAGATGTAGGAACTGGGG - Intronic
1092883040 12:12902718-12902740 GGAGTGCAGTGGTGTGACTGTGG - Intronic
1094504300 12:31048449-31048471 GGCGTGAGTTGCTGTGGCTGGGG - Intergenic
1095812744 12:46387812-46387834 GGAGTGCGAACTTGTGGCTGTGG + Intergenic
1097811877 12:64027783-64027805 GGAGTGAGATGTATTGAATTAGG + Intronic
1098148188 12:67519159-67519181 GGAATGATATGTTGTTACAGGGG - Intergenic
1100480657 12:94975100-94975122 GGGGTGAGATGTTTTGACACAGG - Intronic
1101292250 12:103382844-103382866 GGAGTGAACTGAAGTGACTGAGG - Intronic
1101398519 12:104368702-104368724 GGAGTGAGATGCGGAGATTGGGG + Intergenic
1102629546 12:114265801-114265823 GCAGTGTGGTGTTGTGACAGGGG - Intergenic
1103099804 12:118163760-118163782 GGAGTGCAATGGTGTGACTTCGG + Intronic
1103402932 12:120655464-120655486 GGTGTGAGAGGTGGGGACTGGGG - Intronic
1103439860 12:120955072-120955094 TGGGTGAGATGCTGTGAGTGTGG - Intergenic
1103825204 12:123732388-123732410 GGAATGAAATGATCTGACTGTGG - Intronic
1104383717 12:128330228-128330250 GATGTGGGCTGTTGTGACTGGGG - Intronic
1104569726 12:129914638-129914660 GGAGTCAGATCTTGTCACTCTGG + Intergenic
1105978161 13:25492105-25492127 GGAGTGCCATGTTGTGATTTCGG + Intronic
1108751234 13:53450251-53450273 GGAGTGATATGTTTTGGCTCTGG - Intergenic
1109148237 13:58810121-58810143 GGAGTTTGATGCTATGACTGTGG + Intergenic
1110278879 13:73669621-73669643 GGAGTGAAAGGTTTTGGCTGGGG - Intergenic
1112939555 13:104844909-104844931 GGTGTGAGATGTTGATAGTGGGG + Intergenic
1113982312 13:114286990-114287012 GGAATGAGATGTTTTGCTTGCGG + Intronic
1115937933 14:38576220-38576242 GGAGTGCAATGGTGTGACTTTGG + Intergenic
1116184175 14:41575552-41575574 GGAGTGTAATGTGTTGACTGAGG - Intergenic
1117258279 14:54002650-54002672 GGAGTGAGTTGGTGGGAGTGGGG - Intergenic
1117704739 14:58452966-58452988 GGAGTGCGATGGTGTGATTTTGG + Intronic
1118082146 14:62372883-62372905 GGATTGAGAGGTAGTGACTAGGG - Intergenic
1118163430 14:63313463-63313485 GGAGTGACATGATCTGACTTAGG - Intronic
1118200742 14:63669948-63669970 GGAGTGAGATTATTTGACTTTGG + Intergenic
1119436663 14:74601897-74601919 GAAGGGAGCTGTTGAGACTGAGG + Intronic
1119551796 14:75520138-75520160 GGAGTGACATGATCTGACTTAGG - Intergenic
1120177105 14:81306278-81306300 GGAGTGCGGTGGTGTGATTGTGG + Intronic
1120223255 14:81759693-81759715 GGAGTGCAATGGTGTGACTATGG + Intergenic
1121465460 14:94112710-94112732 GGAGAGAGATGTTGGGGCTCAGG - Intronic
1122010060 14:98738919-98738941 GGAGTGCGATGGTGTGACCTCGG + Intergenic
1123494906 15:20815248-20815270 GGAGGAAGATGTGGTGGCTGAGG - Intergenic
1123551399 15:21384341-21384363 GGAGGAAGATGTGGTGGCTGAGG - Intergenic
1126839733 15:52705749-52705771 GGAGTGAGATGGTGGGGCTGGGG - Intronic
1129888930 15:79058282-79058304 GGTTTGAGATGTTGTGCCTAGGG + Intronic
1130543159 15:84836421-84836443 GGTGTGAGATGATGGGAATGTGG + Intronic
1130925093 15:88379594-88379616 TGAGTGAGGTATTGGGACTGAGG - Intergenic
1131032604 15:89198942-89198964 GGAGGGTGGTCTTGTGACTGTGG + Exonic
1202959741 15_KI270727v1_random:111584-111606 GGAGGAAGATGTGGTGGCTGAGG - Intergenic
1132471433 16:105832-105854 TGAGTGACATGCTGTCACTGAGG + Intronic
1133026068 16:2989492-2989514 GAAGTGAGATGTTGAGCCCGGGG - Intergenic
1133669710 16:8006537-8006559 GGAGTGGGGTGTTGAGAGTGTGG - Intergenic
1134514631 16:14876712-14876734 GGAGGGCTATGTTCTGACTGCGG + Exonic
1136174858 16:28509556-28509578 GGAGTGCAATGGTGTGACTTCGG - Intronic
1136592801 16:31227678-31227700 GGAGTGCAATGGTGTGATTGTGG + Intergenic
1137969125 16:52966190-52966212 GAAGTGGGATGGTGTGACAGGGG + Intergenic
1138245582 16:55464672-55464694 AAAGTGAGATGGTGTCACTGGGG - Intronic
1139487611 16:67267136-67267158 GGAGTGTAATGGTGTGACTCAGG + Intronic
1141312407 16:82927198-82927220 TGAGTGATATTTTATGACTGAGG + Intronic
1142664553 17:1455532-1455554 TGAGGGAGATGTTGGCACTGCGG - Intronic
1143440508 17:6968933-6968955 GGAGAGTAATGTTGTGACTTTGG + Intronic
1143476826 17:7207957-7207979 GGAGGGGGATGCTGGGACTGGGG - Intronic
1144442500 17:15296058-15296080 GGAGAGAGAGGCTATGACTGGGG + Intergenic
1144807629 17:17978253-17978275 GGAGTGAGAAGATGTGGCTCAGG + Intronic
1144864173 17:18324243-18324265 GCCGTGAGCTGTGGTGACTGAGG - Intergenic
1146495586 17:33319177-33319199 GGAGTGCAGTGGTGTGACTGTGG - Intronic
1146937861 17:36823860-36823882 GGCCTGAGAGGTTGTGGCTGTGG + Intergenic
1147245899 17:39120466-39120488 GGCATGAGATGATGTGACTCTGG + Intronic
1147567936 17:41548949-41548971 GGAGGGAGATGTTCAGTCTGAGG - Intergenic
1147662836 17:42126227-42126249 AGAGTGAAATGTTGAGACTCTGG + Intronic
1148033482 17:44639535-44639557 GGAGTGCAATGTTGTGATAGAGG + Intergenic
1148157755 17:45433085-45433107 GGGCTGAGATGGTGGGACTGGGG + Intronic
1149129617 17:53282399-53282421 CCAGTGAAATGTTGTGACTTTGG + Intergenic
1149222380 17:54429812-54429834 GGAGTGCGATGGTGTAATTGTGG - Intergenic
1149639162 17:58192098-58192120 AGAGTGTGAGGCTGTGACTGAGG - Intergenic
1150389431 17:64781775-64781797 GGGCTGAGATGGTGGGACTGGGG + Intergenic
1150790013 17:68196127-68196149 GGGCTGAGATGGTGGGACTGGGG - Intergenic
1150855958 17:68753024-68753046 GGAGTGCAATGGTGTGACTTCGG + Intergenic
1152836052 17:82532635-82532657 GGAGTGCAATGGTGTGATTGTGG + Intronic
1153924163 18:9818841-9818863 GGTGTGAGATTGTGTCACTGTGG + Intronic
1154247418 18:12711559-12711581 GGCGTGATGTGGTGTGACTGGGG - Intronic
1154452312 18:14487769-14487791 GGAGGAAGATGTGGTGGCTGAGG - Intergenic
1159475537 18:68916350-68916372 GGAGTGAGCTGATGGGACAGTGG - Intronic
1161032114 19:2062310-2062332 GGGGTGAGGGGTTGTGGCTGTGG - Intergenic
1161501200 19:4617000-4617022 GGAGTGCGATGGTGTGATTTCGG + Intergenic
1161717570 19:5885521-5885543 GGAGTGTGATGTTGTTTCCGTGG + Intronic
1164647023 19:29866021-29866043 AGAGTGACAGGATGTGACTGAGG + Intergenic
1164990395 19:32678323-32678345 GGAGTGCAATGGTGTGATTGTGG + Intergenic
1165014618 19:32871460-32871482 GGAGGGAGAGGGTGGGACTGCGG - Intergenic
1165300052 19:34963158-34963180 GGAGGAAGATGCTGTGACTCAGG - Intronic
1165977235 19:39686904-39686926 GGTGTGAGATGTTGTGTCACGGG + Intergenic
1166982018 19:46636464-46636486 GGAGAGGTTTGTTGTGACTGTGG - Intergenic
1167598875 19:50442098-50442120 GGAGGGAGATGTGGTGCCTCTGG + Intronic
1167772705 19:51530930-51530952 GGATGGAGATGTTGGGCCTGTGG + Exonic
926379477 2:12271091-12271113 GGAGTCAGATATTATGAATGGGG - Intergenic
927338418 2:21952210-21952232 TGAGTGAAATGTTCTGATTGAGG - Intergenic
928249106 2:29659375-29659397 GGAGTGGGCTGTTCTGCCTGGGG + Intronic
929804785 2:45135577-45135599 GAAGTCAGATGATGTGACAGTGG + Intergenic
930128555 2:47824439-47824461 GGAGTGCGATGGTGTGATTACGG - Intronic
931842977 2:66173989-66174011 GGTGTGAGGTGTTGTAACTAAGG - Intergenic
931926988 2:67084468-67084490 GCAGTGAGGTGTTGGGACTGGGG + Intergenic
932018768 2:68060754-68060776 GGAGTGACATGATCTGACTTAGG - Intronic
932282983 2:70510633-70510655 GCAGAGGGATGTGGTGACTGAGG - Intronic
933027462 2:77278712-77278734 AAAGTAAGATGTTGTGAGTGAGG - Intronic
933506137 2:83179656-83179678 GGAGTGAAATGTTGTGATCACGG + Intergenic
934726364 2:96622605-96622627 GGAGTGACATGATCTGACTTAGG - Intronic
934778401 2:96953522-96953544 GAAGGGAGATGTTGCAACTGTGG - Intronic
935314749 2:101820778-101820800 GGAGTGAGTTGTGGTGAGTCAGG + Intronic
937113358 2:119384702-119384724 GGAATGGGATTCTGTGACTGAGG - Intergenic
938251564 2:129819903-129819925 GGTGTGAGAGGCTGTGACTGAGG - Intergenic
940498274 2:154461681-154461703 GGAGACAGATGTTGGCACTGAGG - Intergenic
940803430 2:158157629-158157651 GGTGTGAGATGATGTGAAAGTGG - Intergenic
941646345 2:168045794-168045816 GGAGTCAGATGTCGTGGTTGGGG - Intronic
942199128 2:173553283-173553305 GAAGTGAGTAGTTGTGACAGAGG + Intergenic
942702583 2:178730326-178730348 GGATTGACATCTTGTGACTGTGG + Exonic
942904385 2:181163422-181163444 GGAGTGCGATGGTGTGATTATGG - Intergenic
942934594 2:181540187-181540209 GGCATCAGCTGTTGTGACTGAGG + Intronic
943096096 2:183431085-183431107 GTAGTCAGAAGTTGTGACTATGG - Intergenic
943939509 2:193973776-193973798 GGAGTGACATGGTGTGACTCTGG + Intergenic
945031188 2:205665217-205665239 GGAGTGCAATGGTGTGACTTCGG + Intergenic
946075390 2:217069681-217069703 GGTGTGATATGTGGTGTCTGTGG + Intergenic
946461296 2:219871117-219871139 GGTGTAAGATCTTGTCACTGAGG + Intergenic
948020578 2:234730023-234730045 TGACTGACATGTGGTGACTGGGG + Intergenic
1168906747 20:1410066-1410088 GGAGTGAGATGTTAAGGCTGAGG - Intergenic
1169103710 20:2975696-2975718 GGCCTGAGATGTTGTGTCTGTGG + Intronic
1171251009 20:23647386-23647408 GGAGGAAGAAATTGTGACTGTGG + Intergenic
1171792335 20:29538614-29538636 GGAGTGCGATGTTGTGATCTCGG - Intergenic
1172966920 20:38842625-38842647 GGAAGGAGCTGTTCTGACTGGGG + Intronic
1173318792 20:41969005-41969027 GGAGGGAGAGGTGGTGTCTGGGG + Intergenic
1173535486 20:43808719-43808741 GGAGTGAGATCGTGTGATTTTGG - Intergenic
1173962075 20:47081888-47081910 GGAGTGCGATGGTGTGACCTTGG + Intronic
1174110561 20:48195159-48195181 GGACTGTGATGCTGAGACTGGGG + Intergenic
1175425147 20:58859675-58859697 GGAGTGCGATGGTGTGATTTTGG + Intronic
1178109268 21:29354245-29354267 GGAGTGACATGTGGTGAGTCAGG + Intronic
1182028532 22:27139024-27139046 GGACTGAGATGCTGTCACAGAGG + Intergenic
1182348293 22:29682745-29682767 GGGGTGAGATGGGGTGTCTGAGG - Intronic
1183008921 22:34928697-34928719 GGAAGGAGATATGGTGACTGGGG + Intergenic
949525251 3:4896946-4896968 GGAGGGGGATATAGTGACTGAGG - Intergenic
950084934 3:10250443-10250465 GAAGTGAGAAGTTCTGCCTGTGG + Intronic
950391814 3:12702729-12702751 GGAGTGAAATGGTGCAACTGAGG - Intergenic
951949025 3:28177926-28177948 GGTGTGAGGTGTTGGGTCTGTGG - Intergenic
952533406 3:34285664-34285686 AGAGGGAAATGTTCTGACTGTGG + Intergenic
954138375 3:48592741-48592763 GGAGTGATAGGTGGTGGCTGGGG - Intronic
954144885 3:48629604-48629626 TGAGTGAGATGGTGTGGATGGGG - Intronic
954985839 3:54790931-54790953 GAAGTGAGAATTTCTGACTGTGG - Intronic
955619782 3:60850457-60850479 GGAGTGAGTTGGTGGGAATGAGG - Intronic
956065195 3:65390284-65390306 GGAGAGAGGTGTTGTGATGGTGG - Intronic
956933187 3:74069677-74069699 GGAGTAAGGTGATGTGAGTGAGG + Intergenic
957095656 3:75775010-75775032 GGAGTGCAATGGTGTGATTGAGG + Intronic
957261024 3:77901440-77901462 GGAGTGAGATGTGGGGATTGAGG + Intergenic
960078605 3:113515975-113515997 GGAGTGAAGTGGTATGACTGTGG - Intergenic
962252720 3:133847098-133847120 GTGCTGAGATGTTGTTACTGTGG - Intronic
962919587 3:139938323-139938345 TGTGTAAGATGTTGTGTCTGTGG + Intronic
963050120 3:141135076-141135098 GGGGTGAGATGGTGGGGCTGGGG - Intronic
964446584 3:156765502-156765524 GGAATGAGGTGTTGAGAGTGAGG - Intergenic
969271742 4:6107890-6107912 GGAGGAAGATGAGGTGACTGTGG + Intronic
970032393 4:11691428-11691450 GGAAGGAGGTGTTGTGACTAAGG + Intergenic
972879138 4:43401750-43401772 GGAGTCAGCAGTTCTGACTGGGG + Intergenic
973561140 4:52137340-52137362 GGTGTCAGATGGTGTCACTGTGG - Intergenic
973855784 4:55008845-55008867 GGAGTGGGCAGTTGTTACTGCGG - Intergenic
974946088 4:68530340-68530362 GGAGTGAGATGATGAGTCTTGGG + Intergenic
982716358 4:158812675-158812697 GGTGTGGGATGTTGATACTGTGG - Intronic
983994910 4:174170182-174170204 GGAGTGCGATGGTGTGAATTCGG - Intergenic
985513409 5:324736-324758 GGAGTGCAATGGTGTGACTTTGG - Intronic
985684070 5:1272530-1272552 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684083 5:1272598-1272620 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684118 5:1272776-1272798 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684132 5:1272846-1272868 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684192 5:1273145-1273167 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684220 5:1273287-1273309 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684234 5:1273357-1273379 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684273 5:1273545-1273567 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684280 5:1273579-1273601 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684305 5:1273690-1273712 GGGGTCTGATGTGGTGACTGTGG - Intronic
985684312 5:1273724-1273746 GGGGTCTGATGTGGTGACTGTGG - Intronic
986182120 5:5402947-5402969 GGAGGGAGATGTTTGGAATGAGG + Intergenic
986833987 5:11613856-11613878 GGAGTCAGATGTAGAGACAGGGG - Intronic
987654803 5:20793977-20793999 AGACTGTGAAGTTGTGACTGAGG + Intergenic
988156317 5:27454811-27454833 AGAGTGAGATGCTGTGCCTATGG + Intergenic
988466730 5:31498804-31498826 GGAGTGAAATGGTGTGATTTCGG - Intronic
988966374 5:36422464-36422486 GATGGGAGATGTTGTCACTGTGG - Intergenic
990738217 5:58887306-58887328 GGAGGGAGCTGTGGGGACTGTGG + Intergenic
991657599 5:68919713-68919735 AGAGTGAGAAGATATGACTGTGG + Intergenic
993469317 5:88287456-88287478 GGAGGGAGTAGTTGTGACCGTGG + Intergenic
993540220 5:89140238-89140260 GGAGTGAGATATTCTGACACAGG - Intergenic
994284551 5:97948975-97948997 AGAGTGAGATCTTGTGTCTAAGG - Intergenic
997429104 5:133825214-133825236 GGAGTGAGCTGTGGTTTCTGGGG - Intergenic
997648278 5:135495902-135495924 GGATTGATATGGTTTGACTGTGG - Intergenic
998143690 5:139713522-139713544 GGAGTGTGATGTTGAGCATGTGG + Intergenic
998503897 5:142656849-142656871 GGAGTGGGATGGGGTGGCTGAGG + Intronic
998572237 5:143272369-143272391 GGAGTGTGATGGTGTGACTATGG + Intergenic
1001462803 5:171933078-171933100 GGAGTGCAATGGTGTGATTGTGG - Intronic
1002438965 5:179254107-179254129 GGAGGGAGAAGTGGGGACTGTGG - Intronic
1003187276 6:3842884-3842906 GGATTGAGATGTTATTAGTGTGG + Intergenic
1005988012 6:30886037-30886059 GGAGAGAGATGAGGTGACTGGGG + Intronic
1006007355 6:31013085-31013107 GGAGGGAGAGGTGGTGGCTGAGG - Intronic
1006067543 6:31472872-31472894 GGGGTGTCCTGTTGTGACTGAGG - Intergenic
1006482964 6:34313560-34313582 GGTGTGAGATGTTGATAATGGGG + Intronic
1007821355 6:44562726-44562748 TGAGTGAGGTTTTGTGGCTGTGG + Intergenic
1008233214 6:49010935-49010957 GGGTTCAGATGTTGAGACTGAGG + Intergenic
1010384937 6:75269093-75269115 GGTGTGAGATGTTGATAGTGGGG - Intronic
1013096440 6:106949678-106949700 GGAGTGCAATGGTGTGACTTTGG - Intergenic
1013777096 6:113690304-113690326 GGAGTGCAATGTTGTGACCTCGG - Intergenic
1013782517 6:113744749-113744771 GGAGTGAGAGGCTGTGGCGGAGG - Intergenic
1013839310 6:114371398-114371420 GGAGTGGGAGGAAGTGACTGGGG + Intergenic
1014451892 6:121591643-121591665 GGAGTGCAGTGGTGTGACTGTGG + Intergenic
1017778386 6:157697288-157697310 GGAGTGAGAGGGAGTGACTAGGG - Intergenic
1020346657 7:7172743-7172765 GGTGTGAGATGTTGATAGTGGGG - Intronic
1021096960 7:16546548-16546570 GGAGTGACATGTTTTCACTTAGG - Intronic
1021526457 7:21593893-21593915 AGAGAGAGATTTTGTGTCTGGGG - Intronic
1022143532 7:27514364-27514386 GGACTGTGGTTTTGTGACTGAGG - Intergenic
1023354130 7:39350280-39350302 GTATTTTGATGTTGTGACTGTGG + Intronic
1024786589 7:52913879-52913901 GGTGTGGGATGTTGAGAGTGAGG - Intergenic
1026604110 7:71801261-71801283 GGAGTGAAGTGGTGCGACTGTGG + Intronic
1029295613 7:99538118-99538140 GGAGTGCAATGGTGTGACTATGG + Intergenic
1032059279 7:128710497-128710519 GGAGAGAGATGAACTGACTGGGG - Intronic
1033354789 7:140590855-140590877 AGAGTGAGATCTTGTTTCTGGGG + Intronic
1033501353 7:141953591-141953613 ATAGTGAAATGTTGTGACTCAGG + Intronic
1034776120 7:153828256-153828278 GGAGGGAGACAGTGTGACTGTGG + Intergenic
1034928382 7:155141202-155141224 GGACTCAGATGCTGGGACTGAGG - Intergenic
1039236933 8:35512096-35512118 GAAGTGAGGTGTTTTGATTGGGG - Intronic
1040443956 8:47474458-47474480 GGAGTGAGATGTTGTGACTGGGG - Intronic
1040900472 8:52412747-52412769 GGAGGGAGGTGGTGTGAATGGGG - Intronic
1041909199 8:63070174-63070196 TGAGTGTGAAGTTTTGACTGTGG - Intronic
1045883879 8:107073128-107073150 GGAGGGAGAAGATGTGACTTAGG + Intergenic
1051007564 9:12365508-12365530 GGAGTGATGTGTTATAACTGGGG + Intergenic
1056091643 9:83211583-83211605 AGAGTGAGATACTGGGACTGTGG + Intergenic
1056214967 9:84398037-84398059 TAAGTGAGAAATTGTGACTGTGG + Intergenic
1056267646 9:84915327-84915349 GGTGAGAGATGTTTGGACTGTGG + Intronic
1056701465 9:88914630-88914652 GGAGTGGGATGTTGATAGTGGGG + Intergenic
1058744791 9:107979890-107979912 GGAGTGACATGCTATGACTTAGG + Intergenic
1062254791 9:135615802-135615824 GGAGAGGGATGTTGGGAATGAGG - Intergenic
1185451308 X:281807-281829 GGAGTGCAATGGTGTGATTGTGG + Intronic
1185713590 X:2323716-2323738 GGAGTGCAGTGGTGTGACTGTGG - Intronic
1187011523 X:15284855-15284877 GGTGTGAGATGCTGTTACAGTGG - Intronic
1187622352 X:21071678-21071700 GGAGTGAGCTGTACTGACTTAGG + Intergenic
1190364936 X:49683510-49683532 GGAGTGACATACTGTGTCTGTGG - Intergenic
1192040911 X:67620436-67620458 GGAGTGAGATGGGGTAAATGGGG + Intronic
1193112176 X:77741160-77741182 GGAGTGCAGTGGTGTGACTGTGG - Intronic
1193714172 X:84917841-84917863 GGAGTGCAATGGTGTGATTGTGG - Intergenic
1196871345 X:120116075-120116097 GGAGTGGGGGGTTGTGAGTGTGG + Intergenic
1197336334 X:125213390-125213412 AGAGTGATATGGTTTGACTGTGG - Intergenic
1197723135 X:129758510-129758532 GGAGTCAGACCTTGGGACTGAGG + Intronic
1198770769 X:140127417-140127439 GGAGTGCAGTGGTGTGACTGTGG - Intergenic
1201580565 Y:15507594-15507616 GATGTGAGATGTTGTTTCTGAGG - Intergenic
1201785470 Y:17772331-17772353 GGAGTGCAATGGTGTGATTGTGG - Intergenic
1201816083 Y:18133656-18133678 GGAGTGCAATGGTGTGATTGTGG + Intergenic