ID: 1040443957

View in Genome Browser
Species Human (GRCh38)
Location 8:47474459-47474481
Sequence GGGAGTGAGATGTTGTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443957_1040443962 -2 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443962 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG No data
1040443957_1040443965 14 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443965 8:47474496-47474518 GTGTTGGTTCTCTTTCTGGTGGG No data
1040443957_1040443963 10 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443963 8:47474492-47474514 CTGAGTGTTGGTTCTCTTTCTGG No data
1040443957_1040443964 13 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443964 8:47474495-47474517 AGTGTTGGTTCTCTTTCTGGTGG No data
1040443957_1040443967 23 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443957_1040443966 22 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443957 Original CRISPR GGGAGTGAGATGTTGTGACT GGG (reversed) Intronic
900558064 1:3289933-3289955 GGGATTGAGGTCTGGTGACTTGG - Intronic
902264207 1:15249751-15249773 GGGAGGGAGAGGTTGTCACTTGG - Intronic
903188521 1:21643026-21643048 GGGAATGACATGTGCTGACTAGG - Intronic
904034092 1:27549908-27549930 GGGAGGTAGACGCTGTGACTGGG - Exonic
905364995 1:37446104-37446126 GGGAGAGAGATGGGGAGACTGGG - Intergenic
905730998 1:40299603-40299625 GGGACTGAGATGCTGTAACTTGG + Intergenic
905788705 1:40778618-40778640 GGGAGGGAGATGACGTGAGTAGG - Intergenic
905943366 1:41882087-41882109 GGGAGTGAGATATGGTTTCTTGG - Intronic
905955914 1:41995907-41995929 GGCAGTGAGATGTTTTGCCTTGG + Intronic
907205250 1:52764763-52764785 GGAAGGGAGATGTTTTAACTTGG + Intronic
910029512 1:82701237-82701259 GGGAGTGGGACGTTGTGGCATGG + Intergenic
910126853 1:83852000-83852022 AGGAGGGAGGAGTTGTGACTTGG - Intergenic
911549541 1:99263082-99263104 AGAAGTGAGAAGTTGTGAATGGG + Intergenic
915288210 1:154866198-154866220 CGGAGTGAGAAGTTGTATCTGGG - Intronic
916330816 1:163614502-163614524 GTCAGTGAGTTGATGTGACTGGG + Intergenic
916686578 1:167152587-167152609 GGGAGTGAAATGTTTTCACAGGG + Intergenic
916929548 1:169561292-169561314 GGGAGTTAGACGCTGTGGCTCGG - Intronic
919328794 1:196142593-196142615 GGGAATGATATGATGTAACTTGG + Intergenic
919785824 1:201258133-201258155 TGGAGTGAGATGGAGTGACATGG + Intergenic
919942040 1:202294685-202294707 GGAAGTGATATAGTGTGACTTGG - Intronic
922053543 1:222018364-222018386 GGGAGTGCAATGTTTTGGCTGGG - Intergenic
1062870531 10:899379-899401 GGGAGTAATCTGTTGTGAGTAGG - Intronic
1063961538 10:11310061-11310083 GTGAGTGAGATGGAGTGAATGGG + Intronic
1064890910 10:20172252-20172274 GAGAGAGAGATGTAATGACTTGG + Intronic
1068530555 10:58181066-58181088 GAGAGTGAAATGATTTGACTCGG + Intergenic
1071995981 10:91149899-91149921 GGGTGGGACATGATGTGACTGGG + Intergenic
1073036721 10:100569052-100569074 GGGAGTGAGATGGGGTGAAGGGG + Intergenic
1075677108 10:124303431-124303453 GAGAGTGGGATGTTAGGACTGGG - Intergenic
1080110167 11:28557630-28557652 AGGAGTGATATGATGTGACTTGG - Intergenic
1083068408 11:59949726-59949748 AGGAGTGACATGATCTGACTTGG + Intergenic
1084178580 11:67435689-67435711 GGGAGTGAGCGGCTGTGACAGGG + Exonic
1086025421 11:82284669-82284691 GTGTGTGAGAGGGTGTGACTGGG - Intergenic
1087255699 11:95949909-95949931 GGGAGTTACATGATGAGACTTGG + Intergenic
1087339440 11:96884304-96884326 GGGGGTGAGATGATGGGGCTGGG + Intergenic
1087967253 11:104432173-104432195 GGGTCTGAGATGTTGAGAATGGG + Intergenic
1088757751 11:112900559-112900581 GGGAGAGGGACGTTGTGAATAGG - Intergenic
1090589559 11:128250778-128250800 TGGAGTGAGATGTTATGGCTTGG - Intergenic
1091030634 11:132184394-132184416 GGGTGTGAGATGTAGGAACTGGG - Intronic
1092058326 12:5525019-5525041 GGGAGTCGGATGTGGTGTCTGGG + Intergenic
1093198330 12:16156233-16156255 GGGTGGGAAGTGTTGTGACTTGG + Intergenic
1094744267 12:33326678-33326700 GAGAGAGAGATCTTGTAACTAGG + Intergenic
1096504247 12:52082590-52082612 GGGAGTGAGATGTGGGGGATGGG + Intergenic
1097007622 12:55930690-55930712 GGGGGTGAGAGGGTGAGACTTGG + Intronic
1097970621 12:65629517-65629539 GGGGGTTAGATGCTGTGACTTGG - Intergenic
1098148189 12:67519160-67519182 GGGAATGATATGTTGTTACAGGG - Intergenic
1100521206 12:95377735-95377757 GGGAGTCAGATGTTGTTAATCGG - Intronic
1101853688 12:108424664-108424686 GGGAGTGAGAGCTTGAGAATTGG - Intergenic
1101887247 12:108676193-108676215 GGAGGAGGGATGTTGTGACTGGG + Intronic
1102690572 12:114757310-114757332 GGGAGAGGGATGCTGGGACTGGG + Intergenic
1102700508 12:114835041-114835063 CGGAGTGAGGAGTTGTCACTTGG + Intergenic
1102923011 12:116807067-116807089 GGGAGTGTCATCTTGTGGCTGGG + Intronic
1103402933 12:120655465-120655487 GGGTGTGAGAGGTGGGGACTGGG - Intronic
1105540334 13:21310845-21310867 GGAAGTGAGGTGTTGTAACTTGG + Intergenic
1105615761 13:22010669-22010691 GGAAGTTAGATGTTGTAATTAGG - Intergenic
1106639142 13:31564678-31564700 GGCAGTGACATGATCTGACTTGG + Intergenic
1107074694 13:36310564-36310586 GGGAGAGAGAAGTTTTAACTAGG - Intronic
1107118471 13:36772775-36772797 GGGAGTGTGATGCTGTGAAAGGG - Intergenic
1110611621 13:77494411-77494433 GGGAGTGATATTTTCTGACACGG - Intergenic
1110614369 13:77524659-77524681 GGGAGAGGGATGTTCTGACAGGG + Intergenic
1112091322 13:96087237-96087259 GGGAGTGCGATGTTGTTAACAGG + Intergenic
1112861148 13:103830645-103830667 GGGAGTGAAATGATATGATTTGG - Intergenic
1114581589 14:23765282-23765304 GAGAGTGTGAAGTTGTGCCTCGG - Intergenic
1117258280 14:54002651-54002673 GGGAGTGAGTTGGTGGGAGTGGG - Intergenic
1117834788 14:59792199-59792221 GAGAGGGAGATTTTGTGATTTGG + Intronic
1118082147 14:62372884-62372906 TGGATTGAGAGGTAGTGACTAGG - Intergenic
1122952990 14:105056176-105056198 GGGAGAGAGTGGGTGTGACTGGG + Intronic
1123089016 14:105733817-105733839 TGGTGTGAGGTGTTGTGACATGG - Intergenic
1123089024 14:105733871-105733893 TGGTGTGAGGTGTTGTGACATGG - Intergenic
1126839734 15:52705750-52705772 GGGAGTGAGATGGTGGGGCTGGG - Intronic
1128715353 15:69903796-69903818 GGGAGGGAGCTGTGGTGACGGGG - Intergenic
1128936255 15:71748945-71748967 GGGTGTGGGATGTTTTGAGTTGG - Intronic
1129888929 15:79058281-79058303 GGGTTTGAGATGTTGTGCCTAGG + Intronic
1129996662 15:80012549-80012571 TGGAGTGGGATGTTGTTAGTGGG - Intergenic
1131934194 15:97484064-97484086 GAGACTGAAATGTTGTGAGTAGG + Intergenic
1135987548 16:27195115-27195137 GGGAGTGATATGGTTTGGCTGGG - Intergenic
1137865586 16:51892754-51892776 GGGAGTGAGAAAATGTGATTTGG + Intergenic
1137911548 16:52383088-52383110 GGAAGCGAGATGGGGTGACTGGG - Intergenic
1141466854 16:84211774-84211796 TGGAGTGAGATTGTGAGACTTGG + Intergenic
1143476827 17:7207958-7207980 GGGAGGGGGATGCTGGGACTGGG - Intronic
1143663975 17:8345625-8345647 GGGAGAGGAAAGTTGTGACTGGG - Intronic
1145003477 17:19321644-19321666 GGGAGTGAGATATTGTGCAGGGG + Intronic
1148157754 17:45433084-45433106 GGGGCTGAGATGGTGGGACTGGG + Intronic
1150389430 17:64781774-64781796 GGGGCTGAGATGGTGGGACTGGG + Intergenic
1150790014 17:68196128-68196150 GGGGCTGAGATGGTGGGACTGGG - Intergenic
1150936023 17:69636709-69636731 GTGGGTGAGAGGTTCTGACTGGG + Intergenic
1154032816 18:10767956-10767978 GGGATGGGGATGTTGTGACTTGG - Intronic
1154083427 18:11279816-11279838 GGGAGGGAGATGCTCTGATTAGG + Intergenic
1154472875 18:14722004-14722026 GGGAGACAGATGATGTCACTTGG - Intergenic
1157088037 18:44602619-44602641 GGAAGTGAGGTGTTGTAACTTGG - Intergenic
1157738195 18:50069421-50069443 GGGGATGGGATGTTGGGACTTGG - Intronic
1157916514 18:51668858-51668880 GTGTGTGAGATGCTGTGGCTGGG + Intergenic
1159396523 18:67865036-67865058 GTAAGTGAGAAGTTGTGAGTTGG - Intergenic
1161811487 19:6473816-6473838 GGGAGGGAAATGATCTGACTCGG + Intronic
1163122129 19:15224243-15224265 TGGAGTGGGAAGTAGTGACTAGG - Intergenic
1164244921 19:23420485-23420507 GGGAGTCACTTGTTCTGACTGGG + Intergenic
1165977234 19:39686903-39686925 GGGTGTGAGATGTTGTGTCACGG + Intergenic
1166434697 19:42757690-42757712 GGGACTTCAATGTTGTGACTTGG - Intronic
1166447549 19:42871456-42871478 GGGACTTCAATGTTGTGACTTGG - Intronic
1168563111 19:57399986-57400008 GGGAATGAGTTGTTGTTAATGGG - Exonic
925851045 2:8082486-8082508 GTGAGGGATATGTTGTGCCTGGG - Intergenic
928335674 2:30396022-30396044 AGGAGGGAGAAGTTGTGACTGGG + Intergenic
929608605 2:43252961-43252983 GGGAGTAAGATGTAGAGACAGGG - Intronic
929938402 2:46311769-46311791 GCTAGTGAGATGTTGAGACATGG + Intronic
931926987 2:67084467-67084489 GGCAGTGAGGTGTTGGGACTGGG + Intergenic
932155128 2:69409691-69409713 AGGAAGGAGATGTTGTTACTGGG + Intronic
935639486 2:105277317-105277339 GGTAGTGATATATTATGACTTGG + Intronic
937664442 2:124468689-124468711 GGGAGTGAGATGTAGTCACTTGG + Intronic
940185012 2:150974722-150974744 GGAGCTGAGATTTTGTGACTGGG + Intergenic
941322741 2:164075568-164075590 GGAAATGAGATCATGTGACTAGG + Intergenic
943315985 2:186387867-186387889 GGGAATGAGATTTAGTGATTTGG - Intergenic
943419540 2:187653559-187653581 GAGAATGAAATGTTGTGACAAGG - Intergenic
947906917 2:233771373-233771395 TGGATTGAGATGTTCTGATTGGG + Intronic
948410369 2:237755150-237755172 GGGATTGCGCTGCTGTGACTGGG + Intronic
1169114101 20:3051764-3051786 GGGAGTGAGGTTGTGTGGCTGGG + Intergenic
1169316403 20:4594125-4594147 GGGAGTGAGGAATTGGGACTGGG - Intergenic
1170563243 20:17575976-17575998 GGAAGTGAGAAGTTTTCACTTGG + Intronic
1171516882 20:25745402-25745424 GGAAGTAAGATGTGGTGTCTTGG + Intergenic
1172806712 20:37617237-37617259 AGGAGTGACATGGTCTGACTTGG + Intergenic
1173978537 20:47205566-47205588 GGTAGGGAGATGATGTGATTGGG - Intergenic
1175072481 20:56345994-56346016 GGGTGAGAGAGGATGTGACTTGG - Intergenic
1184720545 22:46309943-46309965 GGGAGAGAGGTGGTGTGATTTGG + Intronic
1184998239 22:48226190-48226212 GGGAATGTGATGTGGTGCCTAGG - Intergenic
953042427 3:39267209-39267231 GGGGGTGAGATGGGGTGAATTGG + Intronic
956453498 3:69397315-69397337 GGGCGTGAGGTGTCGTGAATAGG + Intronic
957623953 3:82633701-82633723 GGAAGTGAGATGTGGTGAACTGG + Intergenic
959632903 3:108528986-108529008 GGAAGTGAGAAGTTGTGTGTTGG + Intronic
960226062 3:115169759-115169781 GGGAGTGAGATAGGGTGAATAGG + Intergenic
961918175 3:130398852-130398874 GGGAAGGAGATGTTGTAACCAGG - Intronic
962072377 3:132045042-132045064 GGGAGAGAGATGGTGAGAGTGGG + Intronic
962447417 3:135479473-135479495 GGCAGTGAGATGTGATGCCTTGG + Intergenic
963050121 3:141135077-141135099 GGGGGTGAGATGGTGGGGCTGGG - Intronic
969975197 4:11092252-11092274 TGGAGTGCAATGGTGTGACTCGG - Intergenic
970166688 4:13245544-13245566 GGGAAGGAGAGGTTATGACTTGG + Intergenic
973136097 4:46708722-46708744 GGGAGTGATATGGTTTGGCTGGG + Intergenic
974946087 4:68530339-68530361 TGGAGTGAGATGATGAGTCTTGG + Intergenic
983929166 4:173434429-173434451 GGGAAGGAGATCGTGTGACTTGG + Intergenic
984502312 4:180571602-180571624 CAGAGTGAGGTGCTGTGACTTGG - Intergenic
986833988 5:11613857-11613879 GGGAGTCAGATGTAGAGACAGGG - Intronic
987284317 5:16440785-16440807 AGGAGTGAGATGCTGAGACTTGG - Intergenic
990596546 5:57317911-57317933 GGGAGTCACAAGTTGTGATTGGG - Intergenic
991153331 5:63398534-63398556 GTGAGTCACATGTGGTGACTGGG - Intergenic
994114306 5:96044959-96044981 GGAAGTGAGCTGTAGTAACTGGG + Intergenic
995910808 5:117184253-117184275 GGTAGTGAGATCCTGAGACTTGG - Intergenic
997595780 5:135106538-135106560 GGGAATGAGCTTCTGTGACTTGG + Intronic
997864621 5:137450129-137450151 GGGAGTGAGATGTTGAGGTGGGG + Intronic
998017639 5:138745338-138745360 GGGGGTGAGATGTTGAGAAACGG + Intronic
999138505 5:149340377-149340399 GGGAGTGCGATGCTGTGAATGGG - Exonic
1005988011 6:30886036-30886058 TGGAGAGAGATGAGGTGACTGGG + Intronic
1007286432 6:40751040-40751062 GGGAGTTAGGTTTTGTGCCTCGG + Intergenic
1007698318 6:43747859-43747881 TGGAGTGAGATGTTTGGACAGGG - Intergenic
1007814832 6:44514289-44514311 GGGAGGGAGATGCTATGGCTTGG + Intergenic
1008296190 6:49781299-49781321 TTGAGTGAAATGTTGTTACTGGG + Intergenic
1010783726 6:79975225-79975247 GGGAGGGAGGTGGTGTGAATAGG - Intergenic
1013371126 6:109471881-109471903 GGGCCTGAGATGTGGTGACCTGG + Intronic
1013839309 6:114371397-114371419 GGGAGTGGGAGGAAGTGACTGGG + Intergenic
1014271354 6:119340152-119340174 GGGAATGAGATTTTGAGACTGGG + Intronic
1014678125 6:124393655-124393677 GGGGGTGAGGTTTTGAGACTCGG - Intronic
1016752917 6:147650883-147650905 GGGAGAGAGATTTTGGGAGTTGG + Intronic
1017006234 6:150029567-150029589 GGGAGTAAAAGGATGTGACTTGG - Intergenic
1017778387 6:157697289-157697311 GGGAGTGAGAGGGAGTGACTAGG - Intergenic
1017912385 6:158805073-158805095 GGGAGTGAGAAGGTGAGTCTAGG + Intronic
1021526458 7:21593894-21593916 GAGAGAGAGATTTTGTGTCTGGG - Intronic
1021593965 7:22294764-22294786 AGGTGAGAGATGTTGTGGCTGGG - Intronic
1021944068 7:25708298-25708320 GGGAGTGAGAAGCTATGATTGGG + Intergenic
1024088895 7:45919899-45919921 GGGAATGAGATGTTGTTAAGGGG - Intronic
1025145310 7:56496410-56496432 GGGAGTGACATACTGTCACTAGG - Intergenic
1025260911 7:57416909-57416931 GGGAGTGACACATTGTCACTGGG - Intergenic
1029502964 7:100945246-100945268 GGGAGGGACATGTTGAAACTAGG - Intergenic
1029871040 7:103692977-103692999 GTGAGTGAGATTTTCTGAGTTGG + Intronic
1032059280 7:128710498-128710520 GGGAGAGAGATGAACTGACTGGG - Intronic
1032844441 7:135740523-135740545 GGGAGTGAAATGTAGGCACTGGG + Intronic
1033354788 7:140590854-140590876 GAGAGTGAGATCTTGTTTCTGGG + Intronic
1035477953 7:159157065-159157087 GGGAGTGAGCCGTTCTTACTTGG - Intergenic
1035959168 8:4117816-4117838 GAAAGTGAGATGTTCTAACTAGG - Intronic
1038504815 8:28075204-28075226 GGGAAGGAGATGCAGTGACTTGG + Intronic
1040443957 8:47474459-47474481 GGGAGTGAGATGTTGTGACTGGG - Intronic
1041251629 8:55940147-55940169 GGGGGAGAGGTGGTGTGACTAGG - Intronic
1046455606 8:114456068-114456090 TGGAGAAAGATGTTTTGACTTGG - Intergenic
1049405162 8:142449137-142449159 GGAAGTGAGGGGTTGTGCCTAGG - Intergenic
1053196336 9:36121929-36121951 GGGATTAAGATACTGTGACTGGG + Intronic
1053748601 9:41230549-41230571 GGGAATGTGATGTTCTGGCTTGG + Intergenic
1056580532 9:87885989-87886011 TGGAGTGAAATGTTGGGGCTGGG - Exonic
1058314419 9:103546928-103546950 GGCACTGAGATATTGTTACTTGG - Intergenic
1060196062 9:121624100-121624122 GGTAGTGAGATGGTGGCACTAGG - Intronic
1186515625 X:10164460-10164482 GGGAGTGACATGTTGAGACTGGG + Intronic
1187066662 X:15846592-15846614 GGGGGTGGGAGGTTGTGACTGGG - Intronic
1187305558 X:18092130-18092152 GGGGATGCGATGATGTGACTGGG - Intergenic
1187393872 X:18903707-18903729 GGGAGTGAGAGGTGGTGGCCTGG - Intronic
1195783319 X:108487494-108487516 GGGAGTGAGATGGTATCACATGG + Intronic
1196117989 X:112017620-112017642 GGAAGTGAGGTGTTGGGCCTTGG + Intronic
1196315937 X:114223499-114223521 GGCAATGAGATGATGTCACTAGG + Intergenic
1200816924 Y:7542937-7542959 GGGAATGAGATGTTGGGAGGTGG + Intergenic