ID: 1040443958

View in Genome Browser
Species Human (GRCh38)
Location 8:47474460-47474482
Sequence TGGGAGTGAGATGTTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443958_1040443962 -3 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443962 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG No data
1040443958_1040443967 22 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443958_1040443965 13 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443965 8:47474496-47474518 GTGTTGGTTCTCTTTCTGGTGGG No data
1040443958_1040443963 9 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443963 8:47474492-47474514 CTGAGTGTTGGTTCTCTTTCTGG No data
1040443958_1040443966 21 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG No data
1040443958_1040443964 12 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443964 8:47474495-47474517 AGTGTTGGTTCTCTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443958 Original CRISPR TGGGAGTGAGATGTTGTGAC TGG (reversed) Intronic
901183375 1:7356878-7356900 TGGGGTTGAGAGGATGTGACAGG + Intronic
905246363 1:36617096-36617118 TGGGTGTGAGACGGTGTGAGTGG + Intergenic
906838494 1:49109962-49109984 TGGGGGAGAGATGAGGTGACGGG - Intronic
907266754 1:53266413-53266435 TGGGGGTGAGGGGTGGTGACAGG - Intronic
909000658 1:70213556-70213578 TTGGAGTGAGATGTAGTACCTGG + Intronic
909202520 1:72709424-72709446 GGGGAGTGTCATGTTATGACTGG - Intergenic
909349318 1:74630974-74630996 TGGGAGTGAGATGTGGACATGGG + Intronic
916686577 1:167152586-167152608 TGGGAGTGAAATGTTTTCACAGG + Intergenic
920339113 1:205264631-205264653 TGGGTGTGGGATGTGGTGGCGGG - Intronic
920438407 1:205962858-205962880 TGGGAGTGGGAAGTTGTGCCTGG + Intergenic
921127750 1:212192829-212192851 TGGGAGTGGGATGTTGACAGTGG + Intergenic
921794780 1:219329709-219329731 TGGGAGTGAGAGGAAGTGATTGG + Intergenic
922053544 1:222018365-222018387 TGGGAGTGCAATGTTTTGGCTGG - Intergenic
922471147 1:225878103-225878125 TGGGAGTGAGGTGTTGTCTGTGG - Intronic
1062996500 10:1871406-1871428 TTGGAATGAGATGTTATCACAGG - Intergenic
1067185614 10:44024687-44024709 TGGGTGTGGGATTTAGTGACAGG - Intergenic
1073036720 10:100569051-100569073 AGGGAGTGAGATGGGGTGAAGGG + Intergenic
1074890120 10:117728862-117728884 TGGGAGTGGGGTGTAGTGAGGGG + Intergenic
1077864909 11:6214314-6214336 TAAGAGTGAAATGTTGTGCCAGG - Intronic
1078438987 11:11348522-11348544 TGGGAGTGAGATATTTTGGAGGG - Intronic
1079371156 11:19853949-19853971 TGGGACTGATGTGTTGTGAGTGG + Intronic
1080816281 11:35760360-35760382 TGGGAGTGACCTGATGTTACAGG + Intronic
1083213177 11:61202170-61202192 TGGGAGGCAGAGGTTGTGAGAGG - Intergenic
1083757084 11:64797424-64797446 TTGGAGTGGGATGTGGTTACAGG - Intronic
1084178579 11:67435688-67435710 GGGGAGTGAGCGGCTGTGACAGG + Exonic
1086025422 11:82284670-82284692 TGTGTGTGAGAGGGTGTGACTGG - Intergenic
1087339439 11:96884303-96884325 TGGGGGTGAGATGATGGGGCTGG + Intergenic
1087936457 11:104038801-104038823 TGGGAATGAGAGGTGGGGACAGG + Exonic
1090337333 11:125980651-125980673 TGGGAGTGAGATGGTAGCACTGG - Intronic
1090617653 11:128530463-128530485 TGGCAGTGAGAGGTAATGACAGG + Intronic
1090856998 11:130618578-130618600 TGGGAGAAAAATGTTGGGACGGG + Intergenic
1091026819 11:132148802-132148824 TGGGGGTGAGATGATGGGAGGGG + Intronic
1091030635 11:132184395-132184417 TGGGTGTGAGATGTAGGAACTGG - Intronic
1096114023 12:49044672-49044694 TGGGAGTGGGATGTTGGGTGGGG - Intronic
1096429421 12:51530995-51531017 TGGCAGAGAGATGCTCTGACAGG - Intergenic
1096504246 12:52082589-52082611 TGGGAGTGAGATGTGGGGGATGG + Intergenic
1097969196 12:65614353-65614375 TGGGAGTAAGATGCTGAGATGGG - Intergenic
1098148190 12:67519161-67519183 TGGGAATGATATGTTGTTACAGG - Intergenic
1098997678 12:77140000-77140022 TGGGTGGGAGAAGATGTGACAGG + Intergenic
1100269076 12:93006397-93006419 TGGAAGAGAGAGGTGGTGACTGG + Intergenic
1100554884 12:95683593-95683615 TGGCAGGGCGACGTTGTGACAGG - Exonic
1101005143 12:100394473-100394495 TGGGAGGCAGATGTTGCAACGGG - Intronic
1101020856 12:100552643-100552665 TGGGAGTGAGCCACTGTGACTGG - Intronic
1101074628 12:101116048-101116070 AAGGAGTGAGATGTTGTGACTGG + Intronic
1101102123 12:101404943-101404965 TGGGAGGCAGAGGTTGTGGCAGG - Intronic
1101520067 12:105474427-105474449 TGGGGGTGATATGGTGTGACAGG + Intergenic
1103293419 12:119866082-119866104 TGGAGGTGAGGTGTTGTGATCGG - Intronic
1103549854 12:121728992-121729014 TGGGAGGCCGATGTTCTGACTGG + Intronic
1104388953 12:128375236-128375258 TGGGCGGGAGCTGTTGTCACAGG + Intronic
1107038095 13:35921351-35921373 TGAGAGTGGGGTGTTGTGGCCGG - Intronic
1107118472 13:36772776-36772798 AGGGAGTGTGATGCTGTGAAAGG - Intergenic
1110614368 13:77524658-77524680 AGGGAGAGGGATGTTCTGACAGG + Intergenic
1111349723 13:87011682-87011704 TGGGAATGAGAATTTGTTACAGG + Intergenic
1112446498 13:99469340-99469362 TGGGAGCCAGATGGTGTGAAAGG - Intergenic
1115515710 14:34182899-34182921 TGGCAGTCAGATGTTGGGGCTGG - Intronic
1116438357 14:44920788-44920810 AGGGGGTGAGAGGTAGTGACTGG + Intergenic
1117291576 14:54339402-54339424 TGGGTGTGAGCTGCTGTGCCTGG - Intergenic
1118071645 14:62252138-62252160 TGTCATTGAGATGCTGTGACTGG - Intergenic
1120324194 14:83004923-83004945 TGGGGGTGGGGTGTTGTTACAGG - Intergenic
1126839735 15:52705751-52705773 TGGGAGTGAGATGGTGGGGCTGG - Intronic
1127801025 15:62477718-62477740 TTGCAGTGAGATGTTGAGAATGG + Intronic
1128715354 15:69903797-69903819 GGGGAGGGAGCTGTGGTGACGGG - Intergenic
1129137984 15:73571340-73571362 TGGGAGTGAGAAGGTGAGATAGG + Intronic
1130411033 15:83648956-83648978 TGGGAGGGAAGTGTAGTGACAGG - Intergenic
1130421490 15:83751621-83751643 TGGTATGGAGATGTGGTGACTGG + Intronic
1131185453 15:90270163-90270185 TGGGAGTGAGCCATTGTGCCAGG + Intronic
1131185569 15:90271123-90271145 TGCGAGTTAGATGTTCTGATAGG + Intronic
1131600493 15:93843392-93843414 TGGTAGTAAGATGTTGGGAAGGG + Intergenic
1137911549 16:52383089-52383111 TGGAAGCGAGATGGGGTGACTGG - Intergenic
1138879664 16:60995805-60995827 TGGGAGTGGGATGGTCTGAGAGG - Intergenic
1145003476 17:19321643-19321665 GGGGAGTGAGATATTGTGCAGGG + Intronic
1145118105 17:20230882-20230904 TGGGACTGAGAGTTTGTGTCTGG - Intronic
1146456521 17:33013698-33013720 TGGCAGTGAGATGTGATGGCAGG + Exonic
1146814454 17:35931230-35931252 TGGGGGTCAGATGATGTGAGAGG + Intergenic
1150246348 17:63678447-63678469 TGTGAGTGAGATGTTGAGACAGG + Intronic
1150268522 17:63847264-63847286 ACAGAGTGAGATGTTGTGTCTGG + Intergenic
1150496160 17:65609420-65609442 TGGGTCTGAGGTGTTGTGAAGGG + Intronic
1152635276 17:81428304-81428326 TGGGAGCCAGATGCTGTGGCTGG - Intronic
1154321445 18:13356706-13356728 AGGGAGGAAGATGGTGTGACGGG - Intronic
1154948480 18:21185158-21185180 TGGGCGTGAGCTGCTGTGCCTGG - Intergenic
1157020847 18:43779931-43779953 TGGAAGTAAAATGTTGTTACTGG + Intergenic
1157337263 18:46750552-46750574 TGGGAGAGAGAAGTGGGGACAGG - Intronic
1157916513 18:51668857-51668879 TGTGTGTGAGATGCTGTGGCTGG + Intergenic
1158944532 18:62437068-62437090 TTGGAGTGAGATTGTGTGAGGGG - Intergenic
1168314611 19:55479164-55479186 GGGGACTGAGATGGGGTGACAGG + Intronic
925256259 2:2491168-2491190 TGGGAGTGAGAAGTCATGAGGGG + Intergenic
927857378 2:26536008-26536030 AGGGAGTCAGATGCTGTGCCTGG + Intronic
928335673 2:30396021-30396043 AAGGAGGGAGAAGTTGTGACTGG + Intergenic
928921442 2:36532380-36532402 TGGGAGGGAGAGATTGTGAGGGG + Intronic
929050274 2:37830498-37830520 TGGGAGTTGAATGTTTTGACGGG - Intergenic
929608606 2:43252962-43252984 AGGGAGTAAGATGTAGAGACAGG - Intronic
931926986 2:67084466-67084488 GGGCAGTGAGGTGTTGGGACTGG + Intergenic
932097638 2:68865807-68865829 TGGGTGTGAGATGCTCTGCCAGG + Exonic
939982134 2:148794803-148794825 TGGGAATGACAAGTTGTGACTGG + Intergenic
940788251 2:158005079-158005101 TGTTGGTGAGAGGTTGTGACAGG - Intronic
943392922 2:187292961-187292983 TAGGAGTGAAATGTTGTGTGGGG + Intergenic
943424431 2:187712818-187712840 TGGTTGTGAAAAGTTGTGACTGG - Intergenic
946425011 2:219589810-219589832 TGGGAGGGAGAGGCTCTGACAGG + Intergenic
947906916 2:233771372-233771394 TTGGATTGAGATGTTCTGATTGG + Intronic
1169114100 20:3051763-3051785 TGGGAGTGAGGTTGTGTGGCTGG + Intergenic
1169740241 20:8885507-8885529 TGAGAGAGAGATGTTGATACAGG + Intronic
1172610435 20:36247310-36247332 TGGGAGAGAGATGGGGTAACTGG - Intronic
1172935024 20:38614017-38614039 TGGGAATGAGATGTTATAAAAGG - Intronic
1174957105 20:55110216-55110238 TGGTGGTGAGATGTTGGGAAAGG + Intergenic
1175264569 20:57694997-57695019 TTGGAGTGAGATGGGCTGACAGG - Intronic
1177047081 21:16183930-16183952 TGAGTGCTAGATGTTGTGACAGG + Intergenic
1177637163 21:23802354-23802376 TGGTATTGAGAAGTTGAGACTGG - Intergenic
1178410124 21:32356601-32356623 TTGAAGTGATATGATGTGACTGG - Intronic
1181871539 22:25903267-25903289 TGGGATTGAGATGTTGGAGCAGG - Intronic
1181953597 22:26572175-26572197 TGGGAATGAAATGCTGTGATTGG - Intronic
951331166 3:21369294-21369316 TGGGAGGGAAATGATGTAACAGG + Intergenic
951349639 3:21590916-21590938 TAGGAGTGAGAAGTTGCGTCTGG - Intronic
953930955 3:47005420-47005442 AGGGAGGGAGATGCTGTGGCTGG - Intronic
954012609 3:47655323-47655345 TGGGAGGCAGAGGTTGTGATGGG + Intronic
955669346 3:61386392-61386414 TGGTAGTGAGATGTACTGCCGGG - Intergenic
958445847 3:94213963-94213985 AGGGAGTGAGAAATTGTGATCGG + Intergenic
963050122 3:141135078-141135100 TGGGGGTGAGATGGTGGGGCTGG - Intronic
966358495 3:179108010-179108032 TGGGAGTGAGGTGTGGGGAGAGG - Intergenic
966682848 3:182661701-182661723 TGAGATTGAGATGATTTGACAGG + Intergenic
967046256 3:185739870-185739892 TGGGAGTGAGACCTTGTCTCGGG - Intronic
970163721 4:13214733-13214755 TGGGAGTGAGATGAGGGGCCTGG - Intergenic
970247735 4:14080945-14080967 TGGGGGTGAGTTTATGTGACTGG - Intergenic
970522445 4:16899315-16899337 TGGGAGTGAGATGGAGTGGAGGG - Intergenic
972771076 4:42197527-42197549 TGGGACTGAAATGATGTGAAAGG + Intergenic
975712287 4:77172905-77172927 TGAGAGTAAGATGTAGTGATGGG + Intronic
981694261 4:147543868-147543890 TGGGAGGGAGATGTTGGGGTGGG - Exonic
984614198 4:181877697-181877719 TGGAAGAGAGATGTGATGACTGG - Intergenic
986833989 5:11613858-11613880 CGGGAGTCAGATGTAGAGACAGG - Intronic
988317139 5:29644752-29644774 TGGGAGGGACATGTTGTGGGAGG + Intergenic
989989438 5:50743582-50743604 TGGGGGTGAGATGTGGTCTCAGG + Intronic
990408272 5:55513900-55513922 TGGGAGACAGATGTTGTGTAGGG + Intronic
990462381 5:56041298-56041320 TAGGAGTGAGTTATTGTGCCCGG + Intergenic
990596547 5:57317912-57317934 TGGGAGTCACAAGTTGTGATTGG - Intergenic
991153332 5:63398535-63398557 TGTGAGTCACATGTGGTGACTGG - Intergenic
993294280 5:86114710-86114732 TAGGAGTCAGGTGTTGTGATAGG + Intergenic
993760114 5:91784666-91784688 TGTGAGAGAGATGTTGTGAAGGG + Intergenic
994302843 5:98166375-98166397 TGGGAGTGAGAAGATGTGAATGG - Intergenic
995766492 5:115625413-115625435 TGGGTGAGAGATGTTAAGACCGG - Intronic
997864620 5:137450128-137450150 GGGGAGTGAGATGTTGAGGTGGG + Intronic
999138506 5:149340378-149340400 TGGGAGTGCGATGCTGTGAATGG - Exonic
1001085570 5:168697917-168697939 TGGCAGTGAGATATGGTGGCTGG + Intronic
1006079843 6:31558813-31558835 TGGGAGTGAGATGTGGAACCAGG - Exonic
1006917818 6:37606573-37606595 GGGGAGTGAGATGGTGGGGCAGG + Intergenic
1007698319 6:43747860-43747882 GTGGAGTGAGATGTTTGGACAGG - Intergenic
1008672479 6:53785636-53785658 AGGGAGGGAGTTGCTGTGACAGG - Intergenic
1010030939 6:71269987-71270009 TAGGAGTGAGCTGCTGTGCCTGG + Intergenic
1010265143 6:73857337-73857359 TGGGAAAGATATGTTGTGCCAGG + Intergenic
1010812446 6:80315385-80315407 TGGGAGTGACATGTAGTCAAGGG - Intronic
1013138179 6:107303196-107303218 AGGGAGTGGGATGTTGTAAAGGG - Intronic
1013839308 6:114371396-114371418 TGGGAGTGGGAGGAAGTGACTGG + Intergenic
1014271353 6:119340151-119340173 TGGGAATGAGATTTTGAGACTGG + Intronic
1016298104 6:142598003-142598025 TGGAAATGAGATGTAGTGAGAGG + Intergenic
1017353905 6:153479394-153479416 TGGGAGGGAGAGGCAGTGACAGG - Intergenic
1017823977 6:158068342-158068364 TGGGTGTCAGAGGTCGTGACTGG + Intronic
1018250585 6:161866091-161866113 GGGGAGAGAGATGTGGTGATGGG + Intronic
1021834105 7:24650333-24650355 TGGGAGTGAAATATTGAGACAGG + Intronic
1022732558 7:33043780-33043802 TGGGAGTGAGATAGTGGGACTGG + Intronic
1024088896 7:45919900-45919922 GGGGAATGAGATGTTGTTAAGGG - Intronic
1025260912 7:57416910-57416932 TGGGAGTGACACATTGTCACTGG - Intergenic
1027158620 7:75786171-75786193 TGGGAGTCAGGTGTTGTATCTGG - Intronic
1027483074 7:78723823-78723845 AGGGAGATAGATGTTGTGAAAGG + Intronic
1028192817 7:87872499-87872521 TGGGTGTGGGATGTTGTCAAAGG - Intronic
1028828206 7:95298779-95298801 TGGGAGTGATATGATGTGTAGGG - Exonic
1030000561 7:105055329-105055351 TAGGCGTGAGCTGTTGTGCCTGG + Intronic
1031361704 7:120856792-120856814 TGGGAGTAGGATGTGGTGAAAGG - Exonic
1032151908 7:129436032-129436054 AGGGAGGGAGATGATGTGGCGGG - Intronic
1032844440 7:135740522-135740544 TGGGAGTGAAATGTAGGCACTGG + Intronic
1033022697 7:137742508-137742530 TGGGAGTGAGTGGGAGTGACGGG - Intronic
1033038291 7:137895378-137895400 TGGGAGTGAGATGGTTTCCCAGG - Intronic
1033951971 7:146796191-146796213 AGGGAGGGAGATGGTGTCACAGG + Intronic
1035386644 7:158477390-158477412 TGGGAGTGAGATTTGGTGAAGGG + Intronic
1035555801 8:566150-566172 TGAGAGTGAGATGTTCTTCCTGG + Intergenic
1037278419 8:17207135-17207157 TGTCAGTGAGGTCTTGTGACCGG + Intronic
1037357783 8:18040779-18040801 TGGGTGTGAGAGGATGTGAGTGG - Intergenic
1037374936 8:18217428-18217450 TGGGAGGAAGATGCTGTGCCTGG + Intronic
1037532695 8:19793208-19793230 TGGGAATGAGAAGTTGGGACTGG - Intergenic
1040443958 8:47474460-47474482 TGGGAGTGAGATGTTGTGACTGG - Intronic
1042436150 8:68767255-68767277 TGGGAAGTAGAGGTTGTGACTGG - Intronic
1044776215 8:95691325-95691347 TGGGGATGAAATGTTGTGAATGG + Intergenic
1045470656 8:102509399-102509421 TGGGATAGAGATGTTTTCACCGG + Intergenic
1049095331 8:140545150-140545172 TGGGAGTGAGAGGATGTGGGCGG - Intronic
1051269090 9:15337474-15337496 TGGGAGAGAGATGTAGAGGCTGG - Intergenic
1051281944 9:15450233-15450255 TGTGAGTGAGATTTAGTGACTGG + Intronic
1056432977 9:86547047-86547069 TGGAAGTGACAGGTGGTGACTGG + Intergenic
1057665131 9:97038956-97038978 TGGGAGTGAGAGCTTCTGCCCGG - Intronic
1057668937 9:97071323-97071345 CGGGAGTGAGTTGCTGTGCCAGG + Intergenic
1058107745 9:100992364-100992386 TGGGAATTAGATGTTGTGTCAGG + Intergenic
1059004415 9:110385280-110385302 TGGCAGTGAGATGTTTTAAATGG + Intronic
1061339657 9:129969630-129969652 TAGGAGTGAGCCGTTGTGCCTGG - Intronic
1061734573 9:132645192-132645214 TGGGAGTGAGATATACTCACTGG - Intronic
1186515624 X:10164459-10164481 GGGGAGTGACATGTTGAGACTGG + Intronic
1186843909 X:13512198-13512220 TGAGCGTGAGATTTTGTGAATGG + Intergenic
1187066663 X:15846593-15846615 TGGGGGTGGGAGGTTGTGACTGG - Intronic
1187305559 X:18092131-18092153 TGGGGATGCGATGATGTGACTGG - Intergenic
1187449578 X:19384725-19384747 TGGGAGTGAGACCTTGTCTCAGG + Intronic
1194192712 X:90857407-90857429 GAGGAGTGGGATATTGTGACTGG + Intergenic
1195833756 X:109089258-109089280 AGGGAGTGAAATGTTCTGTCTGG + Intergenic
1197233057 X:124027583-124027605 TGTGGGTGAGGTGTTGGGACAGG + Intronic
1197836376 X:130698352-130698374 TGGCAGTTAGCTGTTGTGTCAGG - Intronic
1200080241 X:153572662-153572684 TGGGGGTCAGAAGTTGTGGCCGG - Intronic
1200539340 Y:4439856-4439878 GAGGAGTGGGATATTGTGACTGG + Intergenic
1201968991 Y:19770966-19770988 TGGGAGTGAGATGGGGTCATGGG - Intergenic