ID: 1040443960

View in Genome Browser
Species Human (GRCh38)
Location 8:47474479-47474501
Sequence CAACACTCAGAATTACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443960_1040443964 -7 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443964 8:47474495-47474517 AGTGTTGGTTCTCTTTCTGGTGG No data
1040443960_1040443965 -6 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443965 8:47474496-47474518 GTGTTGGTTCTCTTTCTGGTGGG No data
1040443960_1040443968 21 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443968 8:47474523-47474545 ACGGGCAGCTCTTTGCCTTTAGG No data
1040443960_1040443963 -10 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443963 8:47474492-47474514 CTGAGTGTTGGTTCTCTTTCTGG No data
1040443960_1040443966 2 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG No data
1040443960_1040443967 3 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443960 Original CRISPR CAACACTCAGAATTACTCCT GGG (reversed) Intronic
900905814 1:5556561-5556583 CAACACACAGATTTTCACCTAGG + Intergenic
904742928 1:32692451-32692473 AAACATTCAGTATTACTTCTGGG + Intronic
906707576 1:47905956-47905978 CAGCACTCCACATTACTCCTGGG + Intronic
906951255 1:50336065-50336087 CCACACTCAGATTTCCTTCTGGG - Intergenic
910990063 1:93046635-93046657 CATTACTCATAATTACTCATAGG - Intergenic
913155830 1:116097260-116097282 CCACACCCAGAAAGACTCCTAGG - Intergenic
915727768 1:158030856-158030878 CAGCACTCACACCTACTCCTGGG - Intronic
918182672 1:182097996-182098018 GAACACCCAGAATTAGTTCTAGG + Intergenic
922228175 1:223663768-223663790 CATCTCTGAGAATAACTCCTTGG - Intronic
924920005 1:248619129-248619151 TAACATTCAGTATTTCTCCTGGG - Intergenic
1062973624 10:1666592-1666614 AAACATTCAGAATTCCCCCTCGG - Intronic
1063068381 10:2633965-2633987 CAATACTCAGCAGTATTCCTCGG + Intergenic
1064280926 10:13950985-13951007 CAAGACTGAGAATTCCTCTTTGG + Intronic
1065255960 10:23868214-23868236 CAACCCACAAAATAACTCCTGGG + Intronic
1068742637 10:60491774-60491796 CAAATCTCAGTTTTACTCCTTGG + Intronic
1069664822 10:70147172-70147194 GAACTCTCAAGATTACTCCTAGG + Intergenic
1075904026 10:126065052-126065074 CAGCTCTCAGCATTACTCCTGGG + Intronic
1081276216 11:41152315-41152337 CAAAACTCAGAATTAAACCCAGG + Intronic
1081921770 11:46785037-46785059 CATAACTGAGAATTACTACTAGG + Intronic
1091676906 12:2498201-2498223 CCTCACTTAGAATGACTCCTAGG - Intronic
1093244917 12:16724427-16724449 CGACTCTCAGAATTCCACCTTGG + Intergenic
1093746284 12:22744605-22744627 AAACACACAAAATTACTCCTTGG + Intergenic
1096704565 12:53411024-53411046 CCACACTCAGAGCTACACCTGGG - Exonic
1098605373 12:72382943-72382965 CAAGAATCAGAATTCCTCTTAGG - Intronic
1099669511 12:85672698-85672720 CATCACTCAGAATAATTCCTTGG - Intergenic
1107321748 13:39196521-39196543 AAACACTCTCAATTACTTCTAGG - Intergenic
1109194900 13:59367787-59367809 CCACCCTCAAAATAACTCCTTGG - Intergenic
1113189458 13:107727350-107727372 CCACACTCAGAATTTCTTCCTGG - Intronic
1118715866 14:68559674-68559696 CATTACTCAGAATTGCTCCTGGG - Intronic
1120722498 14:87904027-87904049 CAACTCTTAGAATTACTCTGGGG + Intronic
1124779800 15:32619414-32619436 CAACACACAGCTTTACTCTTGGG + Intronic
1125174074 15:36800041-36800063 CAACACTCTGAAATTCTCCATGG - Intronic
1127190335 15:56523759-56523781 CATCACTCAGAATTACTATTTGG + Intergenic
1127539794 15:59925866-59925888 CATAACTCACAATTACTCTTGGG + Intergenic
1129027574 15:72591983-72592005 CAACACTCCAAATTAGTACTAGG - Exonic
1135094842 16:19556214-19556236 CAGCCCTCAGACTTATTCCTTGG + Intronic
1137790218 16:51168765-51168787 CCACACTCAGAATTAATCCAGGG + Intergenic
1146577549 17:34007941-34007963 CAACACACAAACATACTCCTTGG + Intronic
1146735656 17:35236717-35236739 CCAGAATCAGAGTTACTCCTCGG + Intergenic
1149142665 17:53452859-53452881 CTACACTCAAAAATACTCTTGGG - Intergenic
1151264331 17:72942505-72942527 AAACACTCAGAATTTCTCCTAGG + Intronic
1153291995 18:3510640-3510662 CAAATCTCAGAATGAATCCTGGG + Intronic
1155737342 18:29240054-29240076 CAGAACTGAGAATTAATCCTTGG + Intergenic
1157963711 18:52184460-52184482 AAACATTCAGAATTTCTGCTAGG - Intergenic
1158238789 18:55352376-55352398 CAACACTCAGAAAAACCCCTTGG - Intronic
1158384365 18:56972816-56972838 CACCACTCACAAGTACTTCTTGG + Intronic
1163953878 19:20616168-20616190 AAAGACTCAGAATTGCTGCTGGG - Intronic
1167474793 19:49693625-49693647 CAACAGACAGAATCACGCCTGGG + Intronic
927938495 2:27088839-27088861 GAACACTGAGAATTGCTCCTGGG + Intronic
930934309 2:56929120-56929142 CAACACTCGGAATTACAATTCGG - Intergenic
931178157 2:59874017-59874039 CAGCACTCAGAATTGCTCAGAGG + Intergenic
931205283 2:60140479-60140501 AAACACTCAAAATTACTACCAGG + Intergenic
931565967 2:63615777-63615799 CAACCCTTAGGATTACACCTGGG + Intronic
939849997 2:147292759-147292781 CAACACCCCGAATTTCTCTTCGG - Intergenic
940062677 2:149589724-149589746 CCACAATCTGCATTACTCCTGGG + Intergenic
940329438 2:152458278-152458300 CCTGACTCAGAAATACTCCTTGG + Intronic
948157387 2:235794276-235794298 GAACACTGAGCATTACTCTTGGG + Intronic
1173055194 20:39605095-39605117 CAAGACTCAGAATTATCCCTGGG + Intergenic
1177649656 21:23944254-23944276 CTACACTCAAAATTATTTCTTGG + Intergenic
1178614089 21:34115268-34115290 CAACATTAAGAAGTACTCTTTGG - Intronic
1181479395 22:23188627-23188649 CAAAACTCAGACCTACTCTTTGG - Intronic
950142642 3:10625784-10625806 CTAAACTCAGACTTTCTCCTTGG - Intronic
950864860 3:16181088-16181110 CATCACTCCAACTTACTCCTAGG - Intronic
951799195 3:26576241-26576263 CAACACTGAGAATTACAATTTGG + Intergenic
952196005 3:31075912-31075934 CTCGCCTCAGAATTACTCCTTGG + Intergenic
961940685 3:130634652-130634674 GATCAGTCAGAAATACTCCTGGG + Intronic
962901678 3:139767108-139767130 GGCCAATCAGAATTACTCCTGGG + Intergenic
964308315 3:155363888-155363910 CAAGACCCAGAATTACCCCCTGG - Intergenic
968861769 4:3177052-3177074 CAATACCCAAAATTACACCTTGG - Intronic
969924210 4:10570355-10570377 AAACACTTACATTTACTCCTGGG - Intronic
972174377 4:36385620-36385642 CAAAACACAAAATTACCCCTAGG + Intergenic
972821705 4:42709175-42709197 CAACATTCAGAACTAATCCCTGG + Intergenic
975236531 4:72003674-72003696 AAAATCTCAGAATTAATCCTAGG - Intergenic
977048222 4:92093117-92093139 CATCATTTAGATTTACTCCTAGG + Intergenic
977549034 4:98420885-98420907 CAGCAGTCAGAACCACTCCTAGG + Intronic
980214562 4:129834931-129834953 CAAAACTAAGATTTATTCCTAGG - Intergenic
980262900 4:130477280-130477302 GAAAACTCAAAATTACTCCTTGG - Intergenic
982552440 4:156819726-156819748 TAAAACTCAGAATTACTCCTTGG - Intronic
984112908 4:175642510-175642532 GAAAACTGAGAATTAATCCTTGG - Intronic
985220581 4:187699406-187699428 CAACTATCAGAATCAGTCCTGGG + Intergenic
987248162 5:16070847-16070869 GAGCATTCAGAATTAGTCCTTGG + Intronic
987323060 5:16788089-16788111 CAACAGTCAGAATGATTCTTTGG - Intronic
987966137 5:24877290-24877312 TAACTCTCAGAATTAGTACTAGG + Intergenic
990222582 5:53609257-53609279 CAAAAGTCAAAATTACTCCTTGG + Intronic
991041076 5:62176414-62176436 CAACACTCAGTAGTATTACTAGG + Intergenic
991665031 5:68990987-68991009 GTACACTCAGAATTTTTCCTGGG + Intergenic
993713747 5:91253714-91253736 AAACAATTAGAATTACTGCTTGG + Intergenic
994996555 5:107071209-107071231 GAAAAGTCAAAATTACTCCTTGG + Intergenic
997463150 5:134069306-134069328 CAACCCTCTGAATAAATCCTGGG + Intergenic
997473209 5:134128238-134128260 CAACTCTCAGAAACACACCTGGG - Intronic
1001068715 5:168564172-168564194 CAGCACTCAGCATTAGTCATAGG - Intronic
1003026209 6:2558012-2558034 AAACATTCAGGATGACTCCTAGG + Intergenic
1004741084 6:18461868-18461890 CAACACTCAAAATTCCTGTTTGG - Intronic
1006037636 6:31226013-31226035 AAAGACTCAGAATTGCTCCTGGG + Intergenic
1008945566 6:57092797-57092819 CAAATCACAGAATAACTCCTGGG - Intronic
1009502805 6:64437682-64437704 GAACACACAGAATTATACCTGGG + Intronic
1012060952 6:94479898-94479920 CAACACTCAGCACAACTCCATGG - Intergenic
1012241414 6:96877357-96877379 AAGCATTCAGCATTACTCCTTGG - Intergenic
1014110205 6:117612317-117612339 CTACACTCAGAATCCCTCCTTGG - Intergenic
1015618535 6:135105214-135105236 CAACACTTAGAATAATACCTGGG - Intergenic
1016465608 6:144322078-144322100 CAGCACTGAGAACTACTCCAGGG - Intronic
1016912469 6:149212771-149212793 CTGAACTCAGAATTAATCCTGGG - Intergenic
1017456769 6:154607706-154607728 CAACACTGAGACCTCCTCCTTGG + Intergenic
1019025427 6:168958401-168958423 TGACAATCAGAATCACTCCTAGG + Intergenic
1020715149 7:11665184-11665206 CAACATTCACATTTTCTCCTTGG - Intronic
1021256117 7:18394453-18394475 CAAAATTCAGAAGCACTCCTAGG - Intronic
1024765728 7:52656239-52656261 AATCACTGAGAATTAATCCTAGG - Intergenic
1031390325 7:121205369-121205391 AAACACTCAGAATTACTTATAGG - Intronic
1031468976 7:122146748-122146770 CAACACTGACAATCACTCGTAGG + Intergenic
1031552834 7:123136081-123136103 CGACACTCAGAAATGCTGCTTGG + Intronic
1031625928 7:123992701-123992723 CAACACTTATAGTTATTCCTTGG + Intergenic
1035149875 7:156861054-156861076 CACCACACAGAGTTACTACTGGG - Intronic
1037045470 8:14296319-14296341 CAACTCTCAGCTTTTCTCCTGGG - Intronic
1040149992 8:44104142-44104164 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040155707 8:44188919-44188941 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040168514 8:44378540-44378562 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040176643 8:44498738-44498760 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040179414 8:44539701-44539723 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040195994 8:44785195-44785217 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040213732 8:45048022-45048044 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040226020 8:45229534-45229556 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040266270 8:45823186-45823208 CAACTCTCAGAATTGAACCTTGG + Intergenic
1040443960 8:47474479-47474501 CAACACTCAGAATTACTCCTGGG - Intronic
1042768760 8:72355819-72355841 CAACACTGAGAAATACTGTTAGG + Intergenic
1043940096 8:86187309-86187331 CATCACTCAGAATTAATGTTGGG - Intergenic
1044435435 8:92157059-92157081 GCACACTCAGAATTACCCATTGG - Intergenic
1048163749 8:132043859-132043881 AGACACTCAGAATTACTTTTGGG - Intronic
1049275369 8:141717596-141717618 CAACACTGAGAATTCCTCCTGGG + Intergenic
1050346907 9:4698641-4698663 TAACACCCAGAAATTCTCCTAGG + Intronic
1053420463 9:37974413-37974435 CCAGACCCAGAATTTCTCCTCGG + Intronic
1188741240 X:33784954-33784976 CAACACTCTGAATTTCTCTAGGG + Intergenic
1188938497 X:36207705-36207727 CAAAACTCAGAATTGAACCTGGG + Intergenic
1189110405 X:38284034-38284056 CAAAACTTACAATTGCTCCTAGG + Intronic
1194240995 X:91448204-91448226 AAACACTTAGAATTAATCCTGGG - Intergenic
1194642623 X:96421120-96421142 CAATACTAAGAATTATTTCTTGG + Intergenic
1200775781 Y:7168908-7168930 CAGCACTTAGAATTGCTTCTGGG - Intergenic
1202252844 Y:22890852-22890874 CAAGACTCAAAATTTCACCTGGG + Intergenic
1202405833 Y:24524601-24524623 CAAGACTCAAAATTTCACCTGGG + Intergenic
1202464947 Y:25145481-25145503 CAAGACTCAAAATTTCACCTGGG - Intergenic