ID: 1040443961

View in Genome Browser
Species Human (GRCh38)
Location 8:47474480-47474502
Sequence CCAACACTCAGAATTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443961_1040443965 -7 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443965 8:47474496-47474518 GTGTTGGTTCTCTTTCTGGTGGG No data
1040443961_1040443966 1 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443966 8:47474504-47474526 TCTCTTTCTGGTGGGAGTGACGG No data
1040443961_1040443968 20 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443968 8:47474523-47474545 ACGGGCAGCTCTTTGCCTTTAGG No data
1040443961_1040443967 2 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443961_1040443964 -8 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443964 8:47474495-47474517 AGTGTTGGTTCTCTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443961 Original CRISPR CCAACACTCAGAATTACTCC TGG (reversed) Intronic
903063903 1:20687766-20687788 CCAAGACTCAGGTTTCCTCCAGG - Exonic
906707575 1:47905955-47905977 CCAGCACTCCACATTACTCCTGG + Intronic
910811643 1:91243208-91243230 CCCACCCTCAGAATCAATCCAGG + Intergenic
917075060 1:171196606-171196628 GCATCATTGAGAATTACTCCAGG - Intronic
917721403 1:177789736-177789758 CCAACACTCAGCATAGCACCTGG - Intergenic
919455877 1:197818898-197818920 CCACCACTCACAATTATTCAGGG - Intergenic
924920006 1:248619130-248619152 CTAACATTCAGTATTTCTCCTGG - Intergenic
1065874285 10:29983646-29983668 CACACACTCAGCATTAGTCCGGG - Intergenic
1068938257 10:62657037-62657059 CAAACAGTCAATATTACTCCTGG + Intronic
1074151663 10:110764747-110764769 GCAACACCCAAAATGACTCCAGG + Intronic
1075904025 10:126065051-126065073 GCAGCTCTCAGCATTACTCCTGG + Intronic
1076896450 10:133315090-133315112 CAAACACGCAGATTTACTGCTGG + Intronic
1080225608 11:29956965-29956987 ACATCACTCAGAAATGCTCCAGG - Intergenic
1081304959 11:41500811-41500833 CACACACTTAGAATAACTCCTGG + Intergenic
1084456784 11:69272495-69272517 CCAAGACACAGCATTACTCTGGG - Intergenic
1087145989 11:94812178-94812200 CCACCACTCAGAATCCCTTCAGG + Intronic
1091109872 11:132955946-132955968 CCAGCACCCAGAATAATTCCTGG + Intronic
1093941490 12:25059911-25059933 TCATGACTCAGAATTTCTCCAGG + Intronic
1096283350 12:50276127-50276149 CCAACTCTAAGGATTACTCAAGG + Intronic
1096704567 12:53411025-53411047 CCCACACTCAGAGCTACACCTGG - Exonic
1100137596 12:91572610-91572632 CCAAAACTCAGAAAGACTCATGG + Intergenic
1102037962 12:109782935-109782957 CCAACACTCTAAATGCCTCCCGG + Intergenic
1104278938 12:127355822-127355844 CCAATACTCTGCATTAGTCCAGG + Intergenic
1107004446 13:35592326-35592348 CCAACACTTAGAACAACTCCTGG - Intronic
1109368949 13:61396591-61396613 CCAACCCTGAGAATTGCCCCAGG + Intergenic
1110591853 13:77272270-77272292 CCAACACCAAAAATTTCTCCTGG + Intronic
1112851947 13:103716928-103716950 CCAACAGTCATATTTTCTCCAGG - Intergenic
1118715867 14:68559675-68559697 GCATTACTCAGAATTGCTCCTGG - Intronic
1120722497 14:87904026-87904048 ACAACTCTTAGAATTACTCTGGG + Intronic
1124701780 15:31919979-31920001 CCAACACTGTGACTTGCTCCAGG - Intergenic
1124779799 15:32619413-32619435 CCAACACACAGCTTTACTCTTGG + Intronic
1125886337 15:43232478-43232500 CCTACACTCAGAACCACTTCTGG + Intergenic
1125947172 15:43718981-43719003 CCTACACACAGAATTGCTCATGG + Intergenic
1126658724 15:51009815-51009837 TCAACATTCAGAATTAGGCCAGG - Intergenic
1127736106 15:61840555-61840577 CCAAGACCCAGAGTCACTCCAGG + Intergenic
1128803677 15:70514409-70514431 CCAACGATCAAAATGACTCCTGG + Intergenic
1129294522 15:74592594-74592616 CCCAGACTCAGAATTCTTCCCGG - Intronic
1129655827 15:77525313-77525335 CCAATACTCAGCAGTTCTCCTGG + Intergenic
1132271538 15:100530693-100530715 CCAACACTCATTTTCACTCCGGG + Intronic
1133606167 16:7390222-7390244 CCAACACTGAGAACTACAGCTGG + Intronic
1137790216 16:51168764-51168786 CCCACACTCAGAATTAATCCAGG + Intergenic
1138229072 16:55324600-55324622 CCCACACTCACACTTGCTCCGGG - Exonic
1141515188 16:84539451-84539473 GCGACACTCAGAATACCTCCTGG + Intronic
1149142666 17:53452860-53452882 CCTACACTCAAAAATACTCTTGG - Intergenic
1152049571 17:77961570-77961592 CCAACACTTACATATACTCCAGG - Intergenic
1156404903 18:36774334-36774356 ACAGCACTCAGAAATACTCATGG - Intronic
1157157529 18:45282364-45282386 CCAATTCTTAGAATAACTCCAGG - Intronic
1162203754 19:9040304-9040326 CCCACAGTCAGAGTTACTCATGG + Intergenic
1165989761 19:39803537-39803559 CAAACACTCAGAATAGCGCCTGG - Intergenic
1166691918 19:44827217-44827239 CCAAAACTTAGAATTTATCCTGG + Intergenic
1168491284 19:56812304-56812326 ACAACACTCAGAAATACTCTAGG + Exonic
926399215 2:12478763-12478785 GCAACACTCAGAATAGTTCCTGG + Intergenic
926481040 2:13395454-13395476 GAAACACTCATAATTACTGCTGG + Intergenic
926579651 2:14621285-14621307 CCAACACTCAGAACTGCCTCAGG + Intergenic
927938494 2:27088838-27088860 AGAACACTGAGAATTGCTCCTGG + Intronic
928802972 2:35116174-35116196 AAAACACTTAGAATTATTCCTGG - Intergenic
930758757 2:55007627-55007649 CCAACAATATGAATTACACCAGG + Intronic
931986898 2:67750979-67751001 CCTACACTCAGAACCACCCCTGG + Intergenic
935531106 2:104233631-104233653 CACACACTCAGAAATACTACTGG - Intergenic
936227038 2:110664363-110664385 CCAACAATCAGAAGGACTCTGGG + Intronic
938788798 2:134658465-134658487 CCAATACTCAGAACAACACCAGG - Intronic
941629002 2:167863546-167863568 CCACAAGTCAGAATTACTCAAGG + Intergenic
941672726 2:168311697-168311719 CCCACATTTAGAAATACTCCAGG - Intergenic
942485074 2:176430431-176430453 CAAACACTCTCAATTACTGCTGG + Intergenic
943730344 2:191296579-191296601 CCAACACTCAGGATTTTTCTTGG - Intronic
1173055193 20:39605094-39605116 ACAAGACTCAGAATTATCCCTGG + Intergenic
1174493422 20:50920615-50920637 CCAACCCTCAGAATTACCTGAGG + Intronic
1175238423 20:57528400-57528422 CCATCACGCAAAATTACTCAAGG - Intergenic
1185402187 22:50624985-50625007 CCAGCACACAGCATTACCCCAGG + Intronic
949818204 3:8085050-8085072 CCAAGACTCAAAATTACTCTAGG + Intergenic
954584779 3:51723760-51723782 CCATCAGACAGAATTAGTCCTGG - Intergenic
954677607 3:52324430-52324452 CCACCACTCAGAGCTTCTCCTGG - Intronic
956003021 3:64749261-64749283 CTAATACTCATAATTATTCCAGG - Intergenic
956174489 3:66460146-66460168 CCAGCACCCAGAATAGCTCCTGG + Intronic
956408108 3:68949786-68949808 CCAACACTGAGAAGTACAACAGG + Intergenic
957678915 3:83406011-83406033 CCAACACTGAGCATTACAACTGG + Intergenic
960390383 3:117070807-117070829 CCAACACTCAGGGTGACACCTGG + Intronic
960984149 3:123261886-123261908 GCAACTCTCAGAACTACTCGAGG - Intronic
965515212 3:169614198-169614220 ATAAGACTCAGAATGACTCCAGG + Intronic
965976231 3:174626288-174626310 ACAACACTCAGAATTATTGAGGG - Intronic
966794134 3:183697982-183698004 CCAACACTCACCCTTTCTCCGGG - Exonic
971164775 4:24171593-24171615 CCATCACTCAGAAATATGCCTGG + Intergenic
974405550 4:61463535-61463557 CCAACACTGAGAATTACAACTGG + Intronic
975626859 4:76358954-76358976 CCAACACTAAGAATTACAACAGG - Intronic
975627112 4:76360966-76360988 CCAACACTGGGAATTACAACAGG - Intronic
978833426 4:113116995-113117017 CCCACACTCAGAAATGGTCCCGG - Intronic
981032370 4:140138211-140138233 ACCACACTCAGAAATACTTCTGG - Intronic
981085900 4:140683238-140683260 CCATCACTCAGAAACACTCTAGG + Intronic
981365780 4:143901448-143901470 CCAACACTCAGAGATACACCCGG + Intronic
981375881 4:144015251-144015273 CCAACACTCAGAGATAAGCCCGG + Intronic
981386407 4:144136627-144136649 CCAACACTCAGAGATAAACCTGG + Intronic
983652997 4:170052175-170052197 CAAACACTCAGAACGATTCCTGG + Intergenic
985721663 5:1492825-1492847 CCAACGCTCAGATTCACTCTGGG + Intronic
988236118 5:28547609-28547631 CCAACACTCAGCTTTTCCCCAGG - Intergenic
988436132 5:31177598-31177620 CCAACACTGAGGATTACAACTGG - Intergenic
995834266 5:116384916-116384938 CCAAGGCTCAGAAATGCTCCAGG + Intronic
997463149 5:134069305-134069327 CCAACCCTCTGAATAAATCCTGG + Intergenic
1000495055 5:161972167-161972189 CCAACACTGGGAATTACAACTGG - Intergenic
1003041267 6:2689615-2689637 CTAACATACAGAATTACTCAGGG + Intronic
1006037635 6:31226012-31226034 TAAAGACTCAGAATTGCTCCTGG + Intergenic
1007418498 6:41705881-41705903 CCAACCCTCAGATTCACTGCCGG + Intronic
1009866685 6:69406724-69406746 CCAGTACTCAGAATATCTCCTGG - Intergenic
1010309628 6:74369630-74369652 GCAAAACTCAGCATTACTCTGGG - Intergenic
1010313357 6:74414844-74414866 ACAACAATCAGTATTACTCTTGG - Intergenic
1012666665 6:101979515-101979537 CCAACACTCACAAGTTTTCCAGG - Intronic
1013944148 6:115702994-115703016 CCAACATTGAGAATTACAACTGG - Intergenic
1015618536 6:135105215-135105237 CCAACACTTAGAATAATACCTGG - Intergenic
1016465609 6:144322079-144322101 TCAGCACTGAGAACTACTCCAGG - Intronic
1022691114 7:32655950-32655972 ACTATTCTCAGAATTACTCCTGG - Intergenic
1027943098 7:84710178-84710200 CCAGGACACAGGATTACTCCTGG + Intergenic
1030123003 7:106129025-106129047 CCAACACTCCAAAGTATTCCTGG + Intergenic
1031022191 7:116640369-116640391 CCAGCACTCAGAGTGACTGCTGG - Intergenic
1034027098 7:147717332-147717354 CCAACACTAATAATTAGGCCTGG + Intronic
1035149876 7:156861055-156861077 CCACCACACAGAGTTACTACTGG - Intronic
1037269630 8:17112382-17112404 CTCACACTCAGAATCACTACTGG - Intronic
1038643425 8:29345170-29345192 CCAACACTCAGAATAGTGCCAGG + Intronic
1039820332 8:41128977-41128999 CCAGCTCTCAGAATAACTGCAGG + Intergenic
1040443961 8:47474480-47474502 CCAACACTCAGAATTACTCCTGG - Intronic
1041776726 8:61530787-61530809 CCAATCCTCAGTATAACTCCCGG + Intronic
1043940097 8:86187310-86187332 CCATCACTCAGAATTAATGTTGG - Intergenic
1043983231 8:86664621-86664643 TCAACACTGAGAATAAATCCAGG + Intronic
1044473687 8:92601963-92601985 CCCACACTTAGAAGGACTCCAGG - Intergenic
1049275368 8:141717595-141717617 ACAACACTGAGAATTCCTCCTGG + Intergenic
1060788072 9:126466102-126466124 CCAACATTTAGAATTTCTCATGG + Intronic
1061062568 9:128258022-128258044 CCCACACACAGAATCACCCCCGG + Exonic
1186265374 X:7827410-7827432 CCAACACCCAGAAGTACTTTTGG - Intergenic
1187076019 X:15936024-15936046 TCAAAACTCAGAATTATGCCAGG - Intergenic
1188473863 X:30569329-30569351 CCCACACTCAGAGTTACTTTTGG - Intronic
1188741239 X:33784953-33784975 ACAACACTCTGAATTTCTCTAGG + Intergenic
1189551742 X:42100813-42100835 CCCACACTCAGAAAGACCCCAGG - Intergenic
1192315120 X:70045063-70045085 GCCACACTCAGAATTACTACTGG + Intronic
1194240996 X:91448205-91448227 TAAACACTTAGAATTAATCCTGG - Intergenic
1198828946 X:140728456-140728478 CCAACACCCAGAATTACCCCAGG + Intergenic