ID: 1040443967

View in Genome Browser
Species Human (GRCh38)
Location 8:47474505-47474527
Sequence CTCTTTCTGGTGGGAGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040443958_1040443967 22 Left 1040443958 8:47474460-47474482 CCAGTCACAACATCTCACTCCCA 0: 1
1: 0
2: 2
3: 18
4: 181
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443956_1040443967 24 Left 1040443956 8:47474458-47474480 CCCCAGTCACAACATCTCACTCC 0: 1
1: 0
2: 0
3: 12
4: 279
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443957_1040443967 23 Left 1040443957 8:47474459-47474481 CCCAGTCACAACATCTCACTCCC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443960_1040443967 3 Left 1040443960 8:47474479-47474501 CCCAGGAGTAATTCTGAGTGTTG 0: 1
1: 0
2: 3
3: 15
4: 120
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data
1040443961_1040443967 2 Left 1040443961 8:47474480-47474502 CCAGGAGTAATTCTGAGTGTTGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1040443967 8:47474505-47474527 CTCTTTCTGGTGGGAGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040443967 Original CRISPR CTCTTTCTGGTGGGAGTGAC GGG Intronic
No off target data available for this crispr