ID: 1040447621

View in Genome Browser
Species Human (GRCh38)
Location 8:47511670-47511692
Sequence CGGAGATGGCTATGGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040447621_1040447628 -9 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447628 8:47511684-47511706 CCATCTCCGGCAAATGGTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1040447621_1040447630 -1 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447621_1040447632 17 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447632 8:47511710-47511732 ACTGGTCTCTCCAGGTCTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 184
1040447621_1040447631 9 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447631 8:47511702-47511724 CTTGGTGTACTGGTCTCTCCAGG 0: 1
1: 1
2: 3
3: 43
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040447621 Original CRISPR CGGAGATGGCTATGGCCTTG GGG (reversed) Intronic
900512270 1:3066382-3066404 CGGCCAGGGCCATGGCCTTGGGG + Intergenic
900740898 1:4330162-4330184 CGAAGATGGCTTTTGCATTGTGG + Intergenic
901098764 1:6703039-6703061 CGGGGATGGCTATGGACTGGTGG - Intergenic
911193070 1:94967005-94967027 TGGAAATGGCTATGACTTTGGGG - Intergenic
911740058 1:101377394-101377416 TGGAAATGACTCTGGCCTTGAGG + Intergenic
917667910 1:177243429-177243451 GGGAGATGGTTTTGGTCTTGAGG - Intronic
919755930 1:201066300-201066322 CGGAGATGGCACTGGACCTGGGG + Exonic
920259453 1:204679031-204679053 CTGAGATGGCTGAGGCCTGGTGG + Intronic
922015329 1:221639417-221639439 CTGGGATGGCTACGGTCTTGGGG - Intergenic
1065815706 10:29480696-29480718 CGGCCGTGGCTATGGCCTGGTGG - Exonic
1067144847 10:43687599-43687621 CGGAGATGGTGGTGGCATTGCGG + Intergenic
1070467472 10:76738168-76738190 TGTAGATGGCTATGGCCTGTAGG - Intergenic
1072562342 10:96587265-96587287 CGGAGGCGGCTTCGGCCTTGCGG - Intronic
1076080765 10:127578582-127578604 TGGAGATCACTATGGGCTTGGGG + Intergenic
1076140055 10:128071345-128071367 AGGAAAAGGCTGTGGCCTTGAGG + Intronic
1076871353 10:133196482-133196504 CGGAGACGGCCATGGGGTTGGGG + Intronic
1076910853 10:133388637-133388659 TGAAGATGGCTGTGACCTTGAGG + Intronic
1078549548 11:12270734-12270756 CAGAGATGGCTCTGGCCATTAGG + Intergenic
1080952446 11:37050792-37050814 TGAAGATAGCTATGGCTTTGGGG - Intergenic
1081637982 11:44733653-44733675 CGGAGAAGGGTCTGGCCTTGAGG + Intronic
1083767506 11:64848917-64848939 CACAGAGGGCTATGCCCTTGGGG - Intergenic
1085327436 11:75617837-75617859 CTGAGAACTCTATGGCCTTGTGG - Intronic
1088250240 11:107856208-107856230 AGGAGATGCCAGTGGCCTTGAGG - Intronic
1089198704 11:116710622-116710644 CGGAGATGGCTGGGGCCTTTGGG - Intergenic
1089487100 11:118854972-118854994 TGGAGATGCCTGTGGCCCTGGGG - Intergenic
1089863864 11:121614992-121615014 GGTTGATGGCTTTGGCCTTGAGG - Exonic
1090129351 11:124123532-124123554 CGGAGTTGACTTTGGCATTGGGG + Intronic
1092130636 12:6110494-6110516 CGGTGAGGCCTATGGCTTTGTGG - Exonic
1095311801 12:40707140-40707162 TGGTGATGGCTCTGGCATTGTGG - Intronic
1096491696 12:52016124-52016146 CAGGGATGGCTAAGGACTTGAGG - Intergenic
1098130347 12:67343733-67343755 GAGAGTTGGATATGGCCTTGGGG + Intergenic
1102096893 12:110247945-110247967 CGGAGAAGGCTTTGGCATTCAGG + Intergenic
1104508055 12:129351126-129351148 CGGGGATGGTTATGGGCTTGTGG + Intronic
1106144836 13:27041228-27041250 GGCAGATGGCTCAGGCCTTGGGG - Intergenic
1108973287 13:56403220-56403242 CTGAGATGGTTGTGGCCATGGGG + Intergenic
1113666310 13:112143916-112143938 GGGAGGTGGCTGTGGCCCTGGGG + Intergenic
1122857335 14:104566134-104566156 CTGAGATGGCTCTGCCCATGGGG - Intronic
1124686809 15:31790056-31790078 TGGAGATGGACTTGGCCTTGTGG - Intronic
1130885081 15:88085878-88085900 AGGACATGGCTAGGGCCTTGAGG + Intronic
1131199912 15:90387954-90387976 CGGATAGGGCAGTGGCCTTGGGG + Intergenic
1132002873 15:98197509-98197531 CAGAGATGGTCAAGGCCTTGGGG - Intergenic
1133900689 16:9971368-9971390 TGGAGCTGGCTATTGGCTTGGGG - Intronic
1137667662 16:50261224-50261246 TGGAGAGGTCTATGGCATTGTGG + Intronic
1138516626 16:57539299-57539321 CGGTGATTGCTAAGGGCTTGGGG + Intergenic
1141610062 16:85176271-85176293 TGGAGGTGGCCATGGCCTGGAGG + Intronic
1141949235 16:87330087-87330109 CGGAGCTGGCTGTGGGCTGGGGG + Exonic
1149410280 17:56397943-56397965 CAGAGATGCCTATGGCCTATGGG + Intronic
1151270910 17:72995355-72995377 TGGAGCTGGTTATGGCATTGGGG - Intronic
1153103810 18:1505075-1505097 CTGTGATGGCCATGGCCCTGTGG - Intergenic
1154429886 18:14300379-14300401 TGGAAATGGTTAAGGCCTTGGGG + Intergenic
1157297873 18:46459066-46459088 GGAAGATGGCTTTGGCCTGGAGG + Exonic
1161843023 19:6693980-6694002 AGGGGATGGGCATGGCCTTGAGG + Intronic
1161843056 19:6694087-6694109 AGGGGATGGGCATGGCCTTGAGG + Intronic
1161843089 19:6694194-6694216 AGGGGATGGGCATGGCCTTGAGG + Intronic
1162472119 19:10878583-10878605 CAGAGATGGCTTTGGCATTCTGG + Intronic
1167220742 19:48196632-48196654 CGGAGCTGGCTTTGCCCTTAAGG + Intronic
1167853683 19:52221064-52221086 CGGACATGGCCAAGACCTTGGGG - Exonic
1168628122 19:57934953-57934975 CGGCGCGGGCTATGGCCTGGAGG - Intronic
927652845 2:24922722-24922744 AGGAGCTGGGCATGGCCTTGCGG - Intergenic
935648580 2:105362845-105362867 CTCATATAGCTATGGCCTTGTGG + Intronic
935695595 2:105768413-105768435 CGGAAATGGGGATGGTCTTGTGG - Intronic
936155832 2:110047022-110047044 GGGAGCTGGCTATGCCCCTGCGG - Intergenic
936188856 2:110324406-110324428 GGGAGCTGGCTATGCCCCTGCGG + Intergenic
936669662 2:114642577-114642599 CTGACATGCCTATGGCCTGGGGG - Intronic
941307453 2:163888902-163888924 CGGAGAATGATATGGCCTTTCGG + Intergenic
945446722 2:209947036-209947058 CGGATGTGGCTGTGGCCTTCAGG + Intronic
945775504 2:214102198-214102220 CAGAGATGTCTTAGGCCTTGGGG + Intronic
948693475 2:239721139-239721161 AGGAGATGGCCTTGGACTTGGGG + Intergenic
948864655 2:240769172-240769194 CCGAGATGGGTGTGGCCATGAGG - Exonic
1168911819 20:1454275-1454297 AGGAGGTGGCTACCGCCTTGGGG - Exonic
1173523611 20:43716325-43716347 CGGAGCTCCCTGTGGCCTTGGGG - Exonic
1175964411 20:62653283-62653305 CTGAGATCCCTGTGGCCTTGGGG + Intronic
1176003087 20:62842899-62842921 CTGAGATGGCTCTGTCCTTGGGG + Intronic
1181440452 22:22932861-22932883 AGGAGGGGGCTGTGGCCTTGGGG + Intergenic
1183350614 22:37332808-37332830 CTTAGCTGTCTATGGCCTTGGGG - Intergenic
1185004323 22:48266647-48266669 CAGAGCTGGCTAAGGACTTGGGG - Intergenic
950890276 3:16398591-16398613 CGGACCTGGCTGTGGCCATGGGG - Intronic
952758299 3:36891430-36891452 GGGAGGTGGCCATGGGCTTGAGG - Intronic
955623678 3:60893751-60893773 CCCAGATGGGCATGGCCTTGGGG - Intronic
961338533 3:126200828-126200850 CTGAGGTGGCTGTGGCCATGAGG + Intergenic
963214130 3:142724956-142724978 CGGGGGTGGCTCTGGCCTTGGGG + Intronic
967011552 3:185439578-185439600 CGTAGATGAGTATGGCCTTTTGG + Intronic
968661919 4:1802188-1802210 CGCAGCTGCCTATGGCCCTGAGG - Intronic
969244911 4:5925694-5925716 CAGACATGGCCCTGGCCTTGGGG + Intronic
970265994 4:14286936-14286958 CGGAGATGCCTATGGATATGGGG + Intergenic
975414544 4:74091868-74091890 TGGGGATGGTTATGGGCTTGTGG + Intergenic
981003687 4:139853476-139853498 TGGAGATGGAGATGGCCTGGAGG + Intronic
981034831 4:140158624-140158646 AGCAGATGGCAAGGGCCTTGTGG - Intergenic
981050958 4:140309027-140309049 TGGAGATGGCCAGGGCCCTGGGG + Intronic
982263036 4:153512138-153512160 TGGGGATGGCTATGGCATTTAGG + Intronic
985430122 4:189871165-189871187 CGGTGCTGGGTAAGGCCTTGAGG - Intergenic
985549727 5:526881-526903 CTGTGATGGGCATGGCCTTGAGG + Intergenic
985852323 5:2397839-2397861 AGGGGAAGGCCATGGCCTTGTGG - Intergenic
986791902 5:11169649-11169671 TAGAGACGGCTATTGCCTTGGGG + Intronic
989639594 5:43570053-43570075 TGGGGATGGTTATGGGCTTGCGG + Intergenic
993815035 5:92533126-92533148 GAGACAAGGCTATGGCCTTGTGG + Intergenic
997473932 5:134131906-134131928 GGGACATGGCTGGGGCCTTGGGG + Intronic
997647325 5:135490036-135490058 CGGAGGAGGCGAGGGCCTTGGGG + Intergenic
1001674899 5:173503895-173503917 CTGAGATGGCTAAGGACTAGGGG + Intergenic
1007379175 6:41475869-41475891 TGGAGATGGTGATGACCTTGAGG + Intergenic
1019960813 7:4457938-4457960 TGGAGATGGCTAAGGCTTTGGGG - Intergenic
1022589058 7:31643529-31643551 CTCAGAGGGCTGTGGCCTTGGGG + Exonic
1024572342 7:50733683-50733705 CGGAGAAGGCTGAGGCCTTGGGG - Intronic
1028714606 7:93950425-93950447 TGGTGATGGCAAGGGCCTTGAGG - Intergenic
1037760885 8:21740795-21740817 CTGAGATGGCGAAGGCCTGGCGG - Intronic
1039204602 8:35137561-35137583 CAGAGATTGCTATGGGCTGGGGG + Intergenic
1039517901 8:38148488-38148510 CAGAGAGGGATCTGGCCTTGAGG + Intronic
1039829249 8:41199933-41199955 CAGAGGTGGCTATAGCCTTCTGG - Intergenic
1040447621 8:47511670-47511692 CGGAGATGGCTATGGCCTTGGGG - Intronic
1048478362 8:134764037-134764059 TGGAGCTGGCAAGGGCCTTGGGG - Intergenic
1048965286 8:139610306-139610328 TGAAGCTGGCTAAGGCCTTGTGG - Intronic
1052167997 9:25357402-25357424 TGGAGCTGACTAAGGCCTTGGGG - Intergenic
1053310020 9:37011990-37012012 CTGGGATGGCTCTGGCTTTGGGG + Intronic
1053449282 9:38179842-38179864 CCCAGATGGCTAAGGCCTTCAGG + Intergenic
1053919386 9:42972994-42973016 CGTAGCTGACCATGGCCTTGAGG + Intergenic
1056912819 9:90718841-90718863 AGGAGCTGGCCATGGCCCTGTGG + Intergenic
1057323481 9:94036616-94036638 CAGAGCAGGTTATGGCCTTGTGG - Intronic
1059385611 9:113961946-113961968 AGGAAATGGCTGTGGACTTGGGG + Intronic
1059755851 9:117292639-117292661 CTGAGACAGCTATGACCTTGAGG + Intronic
1061091395 9:128428503-128428525 CGGAGCGGGCATTGGCCTTGGGG + Intronic
1061191117 9:129083282-129083304 TGGAGATGGCTAAAGCTTTGGGG + Intronic
1061996779 9:134190132-134190154 CGGAGAGGCCCAGGGCCTTGGGG - Intergenic
1062228414 9:135466939-135466961 GGGAGAGGGCTGTGGCCATGAGG - Intergenic
1185921927 X:4103069-4103091 GGGAGATGGCCATGGCTTTTTGG - Intergenic
1187192010 X:17044194-17044216 AGCAGATGGTTATGGCATTGAGG + Intronic
1187269205 X:17764811-17764833 AGGAGATGGCTGTGGCTTGGAGG - Intergenic
1187320310 X:18231849-18231871 AGGAGATGGCTGTGGCTTGGAGG + Intergenic
1188171016 X:26926612-26926634 CCGGGATGGCTATGGAATTGGGG - Intergenic
1190872412 X:54435351-54435373 CGGAGGAGGCTATGCCCCTGAGG + Intergenic
1193658828 X:84232035-84232057 CTGAGAGGGTTATGGCCTTGGGG - Intergenic
1194667721 X:96694147-96694169 TGTAGATGGCTGTGCCCTTGAGG + Intronic
1195292487 X:103442416-103442438 CAGAGCTGCCTAAGGCCTTGGGG + Intergenic
1196493254 X:116292780-116292802 TGGGGATGGTTATGGGCTTGTGG + Intergenic
1200244554 X:154516104-154516126 CGGAGATTTCTCTGGCCGTGGGG + Exonic