ID: 1040447622

View in Genome Browser
Species Human (GRCh38)
Location 8:47511671-47511693
Sequence CCGGAGATGGCTATGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040447622_1040447632 16 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447632 8:47511710-47511732 ACTGGTCTCTCCAGGTCTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 184
1040447622_1040447628 -10 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447628 8:47511684-47511706 CCATCTCCGGCAAATGGTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1040447622_1040447631 8 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447631 8:47511702-47511724 CTTGGTGTACTGGTCTCTCCAGG 0: 1
1: 1
2: 3
3: 43
4: 164
1040447622_1040447630 -2 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040447622 Original CRISPR CCGGAGATGGCTATGGCCTT GGG (reversed) Intronic
900430900 1:2602803-2602825 CCCCAGATGGCCATGGCCCTTGG + Intronic
901302826 1:8211924-8211946 CCGGAGGCCGCTATGGCATTTGG - Intergenic
902823264 1:18956289-18956311 GGGGAGATGGCCTTGGCCTTCGG - Exonic
903266537 1:22161261-22161283 CCGGAGCAGGCTCAGGCCTTTGG - Intergenic
915593245 1:156882409-156882431 AGGGAGATGGCTTTGTCCTTAGG - Intergenic
918393739 1:184093271-184093293 CTGGATCTGCCTATGGCCTTAGG + Intergenic
921621378 1:217329822-217329844 ACGGAGATGCCCAAGGCCTTAGG - Intergenic
922015330 1:221639418-221639440 CCTGGGATGGCTACGGTCTTGGG - Intergenic
1063639010 10:7813123-7813145 CCGGAGGGGGCCATGACCTTGGG - Intergenic
1073952653 10:108829014-108829036 GCGGAGCTGCCTAAGGCCTTGGG - Intergenic
1074123085 10:110507795-110507817 CAGGAAAGGGCTGTGGCCTTAGG + Intronic
1075094063 10:119459814-119459836 CCCAAGATGCCTGTGGCCTTTGG + Intergenic
1075959772 10:126558423-126558445 TAGGAGATGGCTGTGGTCTTAGG - Intronic
1077271226 11:1682717-1682739 CCGGAGATGGCCGTGGCAGTGGG + Intergenic
1077860064 11:6170064-6170086 CAAAAGATGGCTAGGGCCTTGGG + Exonic
1083295846 11:61715335-61715357 CCAGAGATGGCTTTGGTCATTGG - Intronic
1083767507 11:64848918-64848940 CCACAGAGGGCTATGCCCTTGGG - Intergenic
1086954912 11:92925762-92925784 GCGGAGATGCCTAGGGCCTTGGG + Intergenic
1087437828 11:98145140-98145162 GCAGAGATGCCCATGGCCTTGGG - Intergenic
1089198705 11:116710623-116710645 ACGGAGATGGCTGGGGCCTTTGG - Intergenic
1097084047 12:56454468-56454490 CTGCAGGTGGCTATGGCATTTGG - Exonic
1101477763 12:105066669-105066691 CAGGTGATGTCTTTGGCCTTAGG - Exonic
1108973286 13:56403219-56403241 CCTGAGATGGTTGTGGCCATGGG + Intergenic
1119662721 14:76463107-76463129 CAGGACATGGCTCTTGCCTTGGG + Intronic
1125816066 15:42585554-42585576 CGGGAGAAGGTTATGGCATTTGG + Exonic
1125836768 15:42758988-42759010 CCAGAAGTGGCTCTGGCCTTAGG - Intronic
1128222016 15:65975972-65975994 TAGGAGAGGGCTATGGCCTGTGG + Intronic
1134239784 16:12496996-12497018 CCGGAGATGAGTGTGGCCTTGGG + Intronic
1135536252 16:23296677-23296699 CCGGAGCTTGCTGTGGCCTCGGG + Intronic
1139111065 16:63891413-63891435 AGAGAGATGGCTAGGGCCTTGGG + Intergenic
1144018457 17:11219742-11219764 TCTGAGATGGCTTTTGCCTTGGG + Intergenic
1149410279 17:56397942-56397964 ACAGAGATGCCTATGGCCTATGG + Intronic
1154429885 18:14300378-14300400 CTGGAAATGGTTAAGGCCTTGGG + Intergenic
1160014042 18:75127417-75127439 CCGGAGCTGGCTATCTCCTGGGG - Intergenic
1160699182 19:497877-497899 CCGGTGGTGGCCGTGGCCTTGGG + Exonic
1167313746 19:48752373-48752395 GCGGAGATTCCTAGGGCCTTAGG + Intronic
1167853684 19:52221065-52221087 CCGGACATGGCCAAGACCTTGGG - Exonic
926104471 2:10141761-10141783 CAGGAGGTGGCCATGGCCTGGGG + Intronic
930152290 2:48070934-48070956 GGGGAGATAACTATGGCCTTGGG - Intergenic
931150563 2:59568207-59568229 CCTGAGATTTCTTTGGCCTTTGG - Intergenic
932338541 2:70944535-70944557 CTTGTGATGGCGATGGCCTTGGG + Intronic
933487311 2:82938850-82938872 AGGGAGCTGGCTCTGGCCTTGGG + Intergenic
935714274 2:105926266-105926288 CCAGAGATGGAAATGGCCTTGGG + Intergenic
944277002 2:197850593-197850615 CCTGATATGTATATGGCCTTCGG - Intronic
944685406 2:202113213-202113235 CCGTAGATGCCTATGTGCTTGGG - Intronic
945132364 2:206586478-206586500 TAGAAGATGACTATGGCCTTTGG + Intronic
945775503 2:214102197-214102219 CCAGAGATGTCTTAGGCCTTGGG + Intronic
947091021 2:226511523-226511545 CCAGAAAGGGCTATGACCTTGGG + Intergenic
948693474 2:239721138-239721160 CAGGAGATGGCCTTGGACTTGGG + Intergenic
1168911820 20:1454276-1454298 CAGGAGGTGGCTACCGCCTTGGG - Exonic
1173008324 20:39157897-39157919 CCGGACATGGCTTTTGCCATTGG + Intergenic
1173094362 20:40010792-40010814 CCTTAGATGGCTGTTGCCTTTGG + Intergenic
1175964410 20:62653282-62653304 CCTGAGATCCCTGTGGCCTTGGG + Intronic
1176003086 20:62842898-62842920 GCTGAGATGGCTCTGTCCTTGGG + Intronic
1178126973 21:29526485-29526507 GCGGAGCTGCCTAAGGCCTTGGG - Intronic
1181085868 22:20439058-20439080 CTGGTGATGCCCATGGCCTTGGG - Intronic
950890277 3:16398592-16398614 CCGGACCTGGCTGTGGCCATGGG - Intronic
963214129 3:142724955-142724977 TCGGGGGTGGCTCTGGCCTTGGG + Intronic
967294162 3:187949239-187949261 CAGGAGAGGGCTGTGGCCTTTGG + Intergenic
969244910 4:5925693-5925715 CCAGACATGGCCCTGGCCTTGGG + Intronic
973852858 4:54977979-54978001 CTGGACATGCCTAGGGCCTTGGG + Intergenic
975609921 4:76193502-76193524 GCGGAGCTGCCTAAGGCCTTGGG + Intronic
975644087 4:76528974-76528996 TCTGAGATGGCTTTGGCTTTAGG + Intronic
976384207 4:84436501-84436523 CCTGAGATATCTATGGCCATGGG - Intergenic
976695306 4:87913080-87913102 CCTGAGAAGGCTATAACCTTAGG + Intergenic
985175997 4:187201833-187201855 CCGGTGATGTCTAGGGCCTGAGG - Intergenic
989233137 5:39110373-39110395 TCGTAGATGGTTATGTCCTTCGG - Exonic
990909818 5:60842728-60842750 GCTGAGATGGGTGTGGCCTTGGG + Intronic
998530181 5:142877079-142877101 CTGCAGATTGCTATGGCCTGTGG + Intronic
1001824064 5:174732091-174732113 CCGGGAAAGGCTTTGGCCTTTGG - Intergenic
1004076800 6:12351271-12351293 GCAGAGATGCCTAAGGCCTTGGG - Intergenic
1007954337 6:45902580-45902602 ACCGAGCTGGCTATGGACTTGGG - Exonic
1011891772 6:92172359-92172381 GCAGAGATGAATATGGCCTTGGG - Intergenic
1017992070 6:159499376-159499398 CCTGAGATGGCCTTGGCATTTGG - Intergenic
1019401123 7:854555-854577 CTGGAGACGGCGAGGGCCTTGGG + Intronic
1019960814 7:4457939-4457961 GTGGAGATGGCTAAGGCTTTGGG - Intergenic
1023086133 7:36571554-36571576 CAGGAGATGGCTGTAGCCTGGGG - Intronic
1024572343 7:50733684-50733706 CCGGAGAAGGCTGAGGCCTTGGG - Intronic
1027359709 7:77395367-77395389 CAGGATATGGCTGTGACCTTTGG - Intronic
1030156559 7:106461231-106461253 ATGGAGGTGGCTCTGGCCTTTGG - Intergenic
1035225116 7:157428475-157428497 AAGGAGAAGGCTATGGGCTTTGG - Intergenic
1039158926 8:34595451-34595473 ACAGAGCTGCCTATGGCCTTAGG - Intergenic
1040447622 8:47511671-47511693 CCGGAGATGGCTATGGCCTTGGG - Intronic
1046573736 8:115999250-115999272 CAGAAGATGGCTTTGGACTTTGG - Intergenic
1051612285 9:18972851-18972873 TTGGAAATGGCCATGGCCTTAGG - Intronic
1057664192 9:97031273-97031295 CCAGAGATGGCTGTGGACATAGG + Exonic
1062591342 9:137276169-137276191 CAGGAGATGGTGATGGCCCTGGG + Intergenic
1187649913 X:21391065-21391087 CCAGAGCTGCCCATGGCCTTGGG - Intronic
1192977967 X:76306514-76306536 CCTGAGATGGCAGTGGCCATAGG - Intergenic
1193308341 X:79975766-79975788 ACTGAGAAGGCTATGGCCTGGGG - Intergenic
1193577270 X:83214678-83214700 CCTTAGATGGCTTTGGACTTTGG + Intergenic
1193658829 X:84232036-84232058 ACTGAGAGGGTTATGGCCTTGGG - Intergenic
1196518254 X:116640090-116640112 CCAGAGATGCCCAAGGCCTTGGG - Intergenic
1198579601 X:138049026-138049048 CTGTAGGTGGCTTTGGCCTTTGG + Intergenic
1200244553 X:154516103-154516125 CCGGAGATTTCTCTGGCCGTGGG + Exonic