ID: 1040447625

View in Genome Browser
Species Human (GRCh38)
Location 8:47511678-47511700
Sequence CCATTTGCCGGAGATGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040447625_1040447631 1 Left 1040447625 8:47511678-47511700 CCATAGCCATCTCCGGCAAATGG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1040447631 8:47511702-47511724 CTTGGTGTACTGGTCTCTCCAGG 0: 1
1: 1
2: 3
3: 43
4: 164
1040447625_1040447630 -9 Left 1040447625 8:47511678-47511700 CCATAGCCATCTCCGGCAAATGG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447625_1040447632 9 Left 1040447625 8:47511678-47511700 CCATAGCCATCTCCGGCAAATGG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1040447632 8:47511710-47511732 ACTGGTCTCTCCAGGTCTGTTGG 0: 1
1: 0
2: 2
3: 25
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040447625 Original CRISPR CCATTTGCCGGAGATGGCTA TGG (reversed) Intronic
901166713 1:7226560-7226582 CCATTTCCCAGAGATAGCCAGGG + Intronic
902188357 1:14742406-14742428 CCATATGCCAGAGATGACTCAGG + Intronic
903734508 1:25521849-25521871 CCCTTTGCCGGAAATGTCTAAGG + Intergenic
908802012 1:67890020-67890042 CCATTTTCTGGTGATGGCAAAGG + Intergenic
912524792 1:110273599-110273621 CGATTTGCTGGAGAGGGCCAGGG - Intronic
912657081 1:111496422-111496444 CCATTAGTCGAAGATGGCTCTGG + Intronic
913685930 1:121231996-121232018 CCATTGGCAGGAGATGTGTAGGG + Intronic
914037781 1:144019599-144019621 CCATTGGCAGGAGATGTGTAGGG + Intergenic
914151672 1:145048333-145048355 CCATTGGCAGGAGATGTGTAGGG - Intronic
920473253 1:206250553-206250575 CCATTGGCAGGAGATGTGTAGGG + Intronic
1064541622 10:16411681-16411703 CCAATTTCCGGAGATGACAACGG + Intergenic
1069214961 10:65808224-65808246 CCACTCGTCAGAGATGGCTAAGG + Intergenic
1080935783 11:36862021-36862043 CTATTTCCCTGAGGTGGCTAAGG + Intergenic
1090274405 11:125409457-125409479 CCATGTGCCGAAGGTGGCTGAGG + Intronic
1090831618 11:130424628-130424650 CCATTTGCAGGAGGTGGGTGTGG + Intronic
1091580818 12:1787794-1787816 CCTTTTGCTGGAGATTGCAAGGG - Exonic
1106051394 13:26193165-26193187 ACATTTGGGGGAGATGTCTATGG + Intronic
1118842872 14:69526051-69526073 CGATCTGCCGGAGGTTGCTATGG - Exonic
1120595517 14:86430487-86430509 TAATTTGCCTGAGATTGCTATGG + Intergenic
1127972431 15:63971861-63971883 CCATATGCCTGAGATGGCAGGGG + Intronic
1131970758 15:97890454-97890476 CCATTAGCCCAAGATGGCCAGGG - Intergenic
1147599124 17:41734873-41734895 CCATTCTCCGGAGATGGAGAGGG - Intergenic
1152115205 17:78382196-78382218 CCATTTCCAGGAGCTGACTAGGG + Intronic
1154370063 18:13752320-13752342 TCATTTGCAGGATATGGCTGGGG - Exonic
925208513 2:2027044-2027066 CCTTTTGCTGGAGGTGGCGAGGG - Intronic
926615450 2:14992563-14992585 CCATTTTCAGGAGATGGTTCAGG + Intergenic
929823380 2:45291123-45291145 CCATTTGCCAGGGATGGAAAGGG - Intergenic
930267640 2:49218538-49218560 CCATTTGGCATAGATGGCTCAGG + Intergenic
941982072 2:171469634-171469656 CCATGTGCCAGACATGACTAAGG + Intronic
948729203 2:239952642-239952664 CCCTGTGCCAGACATGGCTATGG + Intronic
1168790181 20:570979-571001 CCATATGCCGAAGAGGTCTATGG - Intergenic
1170962327 20:21036445-21036467 GCATATGCCGGAGATGACCAAGG + Intergenic
1171864089 20:30465226-30465248 CCATAAGCCTCAGATGGCTAAGG + Intergenic
1173008636 20:39160441-39160463 CCATTTTACAGAGATTGCTATGG + Intergenic
1173417855 20:42873749-42873771 TCATTAGCCGCACATGGCTACGG - Intronic
1175384096 20:58583213-58583235 CCATTTGCTGGAAATGACCAAGG + Intergenic
1175696136 20:61104420-61104442 CCATTAGCGGGAAATGGCTGTGG + Intergenic
1178938432 21:36884276-36884298 CCATTTGTAGGAGATTGGTAAGG - Intronic
1182920765 22:34076931-34076953 GCATTTGCCTGAGATGGCTAAGG - Intergenic
1185117789 22:48947802-48947824 CCCTTTGAGGGAGATGGCCATGG - Intergenic
955779186 3:62465059-62465081 TCATTTGCCAGAGCTAGCTAAGG + Intronic
961178896 3:124860597-124860619 CCCTTTGCCGGAAATGACCAGGG - Intronic
965905726 3:173702986-173703008 CCATTAGCATGGGATGGCTAGGG - Intronic
969826712 4:9763590-9763612 CCCTTTGCTGGAGATGGGCACGG + Intergenic
986081615 5:4400509-4400531 CCATTTGCTGGAGGTGGCAGAGG - Intergenic
986964578 5:13254918-13254940 CCATTTTCCCAAGAAGGCTATGG + Intergenic
995238813 5:109861862-109861884 CCATTGGCGGGAGAAGACTAAGG + Intronic
1000822568 5:166002633-166002655 CCATTTTCCACAGCTGGCTAAGG + Intergenic
1001575400 5:172760044-172760066 CCATTTGTAGGAGGTGTCTAGGG - Intergenic
1002934677 6:1661603-1661625 CCACTTGCTGGGGATGGCGAGGG - Intronic
1002961712 6:1921589-1921611 CCATTTTCCTGATCTGGCTATGG - Intronic
1009948176 6:70364296-70364318 CCTTTTGCCAGAGAGGGCAAAGG + Intergenic
1010188777 6:73172979-73173001 CCATTTTCTAGAGATGACTAAGG + Intronic
1010905492 6:81481744-81481766 CCAACTGCTGGAGATGGCCAGGG - Intergenic
1015132349 6:129827115-129827137 CCATGTGACTGAGCTGGCTAAGG + Intergenic
1022132846 7:27419937-27419959 CCATTTGCTGGCTATGGCTCAGG - Intergenic
1028698176 7:93742145-93742167 AAATTAGCCGGAGATGGCGACGG + Intronic
1040372169 8:46787947-46787969 CCAGTTGCTGGGGGTGGCTAGGG + Intergenic
1040447625 8:47511678-47511700 CCATTTGCCGGAGATGGCTATGG - Intronic
1042345789 8:67726382-67726404 TCATTTGCCAAAGAAGGCTAGGG - Intronic
1050588116 9:7134115-7134137 ACATTTGCCAGAGAAGGCTTTGG + Intergenic
1060101272 9:120842992-120843014 CCTTGTCCCTGAGATGGCTATGG + Intergenic