ID: 1040447630

View in Genome Browser
Species Human (GRCh38)
Location 8:47511692-47511714
Sequence GGCAAATGGTCTTGGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040447624_1040447630 -3 Left 1040447624 8:47511672-47511694 CCAAGGCCATAGCCATCTCCGGC 0: 1
1: 0
2: 0
3: 9
4: 193
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447622_1040447630 -2 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447620_1040447630 11 Left 1040447620 8:47511658-47511680 CCTCTGGTGCTGCCCCAAGGCCA 0: 1
1: 0
2: 5
3: 36
4: 264
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447625_1040447630 -9 Left 1040447625 8:47511678-47511700 CCATAGCCATCTCCGGCAAATGG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447621_1040447630 -1 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447617_1040447630 29 Left 1040447617 8:47511640-47511662 CCACATAAGCAGACTCTTCCTCT 0: 1
1: 1
2: 1
3: 25
4: 292
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040447630 Original CRISPR GGCAAATGGTCTTGGTGTAC TGG Intronic
900935984 1:5766573-5766595 GGGTAATGGGCTTGGTGTCCTGG - Intergenic
904487507 1:30836910-30836932 GGCAAAGGATGTTGGTGTTCGGG - Intergenic
905495200 1:38379518-38379540 GGCAAGCAGTCTTGGTGTAGCGG - Intergenic
911019711 1:93374515-93374537 GGCAAGTGCTCATGCTGTACTGG - Intergenic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
915285856 1:154851615-154851637 GACAAAAGGTCATGGTGTGCAGG - Intronic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG + Intergenic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG + Intronic
1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG + Intronic
1072747021 10:97947697-97947719 GAAGCATGGTCTTGGTGTACTGG + Intronic
1074794651 10:116930298-116930320 GTCACAGGGGCTTGGTGTACAGG + Intronic
1076738137 10:132467856-132467878 GGCAGGTGGCCTTGGTGGACGGG - Intergenic
1078665457 11:13321328-13321350 GGCACATGTGCTTGGTATACAGG - Intronic
1080013784 11:27483946-27483968 AGCAAATGTACTTGGTGTGCTGG - Intergenic
1080357634 11:31470125-31470147 GGCAAATGGGCTGGGTGCAGTGG + Intronic
1082716205 11:56617323-56617345 GTCACAGGGTTTTGGTGTACAGG + Intergenic
1088830183 11:113530235-113530257 AGCAAATGGCCTTGGTACACTGG - Intergenic
1094065407 12:26356523-26356545 GGCACAAGGTGTTGGTGAACAGG + Intronic
1094529834 12:31263860-31263882 AGCAAAAGTTCTTAGTGTACGGG - Intergenic
1102327615 12:112001462-112001484 GCCAAATGGTCCAGGTGTAGTGG - Intronic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1114794110 14:25692985-25693007 AGCAAATGGTTTTGGAGTTCCGG + Intergenic
1115969658 14:38931755-38931777 GGCAAATGATCATGGTGGACAGG + Intergenic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG + Intronic
1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG + Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1134365770 16:13577391-13577413 GGTAAATGTTCTGTGTGTACTGG - Intergenic
1140866289 16:79065443-79065465 GGAAAATGGTCCTCGTGCACTGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1149900854 17:60476618-60476640 GACATAAGGTCTTGGTATACAGG + Intronic
1150709662 17:67519833-67519855 GGCAAGTGGTTTTGGGGTTCTGG - Intronic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1152026356 17:77811959-77811981 GGCAGATGGTCTTCGTGCATGGG - Intergenic
1158350739 18:56562750-56562772 GGCAATTGGTCCTGGTGATCGGG - Intergenic
1162779886 19:13001470-13001492 GTCAACGGGTATTGGTGTACCGG + Intronic
1162807174 19:13144115-13144137 GGCAAATGGCTTTGGGGTCCTGG + Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164217550 19:23163038-23163060 GGCAACTGGTCTGGGTGCCCTGG + Intergenic
1164269538 19:23659369-23659391 GACAAATTGTCTTGCTGTGCAGG - Intronic
1166993377 19:46706461-46706483 GGCAAATGGTCTTTGCACACAGG + Intronic
1167106536 19:47433113-47433135 AGCAAACGGTCTTGGGGAACTGG - Intronic
926157624 2:10466035-10466057 GGCAGATGGCTTTGGGGTACAGG - Intergenic
933936023 2:87204382-87204404 GGAAACTGGTCTGGGTGTCCTGG + Intergenic
936357125 2:111761447-111761469 GGAAACTGGTCTGGGTGTCCTGG - Intergenic
938643424 2:133306753-133306775 GGCAACAGGTTTTGGTGTATTGG + Intronic
939783383 2:146477303-146477325 GGCATAAGGTCTTGCTTTACAGG - Intergenic
944381716 2:199118154-199118176 GGGAAATGGTCTTCTTGTATAGG - Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173674775 20:44824172-44824194 GGCAGATGGTCTTAGACTACAGG - Intergenic
1177281126 21:18984441-18984463 GGAAAATGGTCCTTGTGTCCTGG - Intergenic
1177972825 21:27811289-27811311 GGCAAATGTTCTTGGTATGTGGG + Intergenic
1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183834433 22:40440631-40440653 AGCAAGTGCTCTTGGTGCACTGG + Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
961179797 3:124867572-124867594 GGAGAATGGGCTTGGTGTACTGG - Intronic
963852217 3:150220323-150220345 GGCAAATGGCCTTGGCGTTAGGG - Intergenic
964996254 3:162885207-162885229 GGCAAATTGTGGTGGTGTATAGG + Intergenic
966384306 3:179379223-179379245 GGAAAATGCTGTTGGTGCACTGG - Intronic
968137010 3:196227053-196227075 GGCAAAGGGTGTTCTTGTACAGG - Exonic
973733174 4:53843302-53843324 GGCAAATGGGCTGGGTGCAGTGG + Intronic
985566913 5:623540-623562 GAGAAATGTTCTTGGAGTACGGG + Intronic
985793795 5:1947223-1947245 GGCAAATTGTCTTGGGGAAAGGG - Intergenic
986237320 5:5924102-5924124 GGCAAATGGTCTTGGTTCACTGG + Intergenic
990728193 5:58779739-58779761 GGTAGATGGTCTTTGTGTACTGG + Intronic
991573240 5:68077293-68077315 TGCAAATAGACTTGGTGGACAGG + Intergenic
993724767 5:91354877-91354899 AACAAGTGGTCTTAGTGTACTGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007777984 6:44234354-44234376 GGCTAACAGTCTTGGTGTTCTGG - Intergenic
1010159759 6:72839237-72839259 TGGAAATTGTCTTGGTATACTGG + Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1012612252 6:101230633-101230655 GGAAACTGGTCTGGGTGTCCTGG + Intergenic
1012988607 6:105901305-105901327 GGAAAATGGTCATGATGTACTGG - Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1017173406 6:151478935-151478957 GGGAAATGGTTTTTGTGAACAGG + Intergenic
1017959351 6:159208289-159208311 GGCAACTGGTATTGGTCTTCTGG + Intronic
1021489459 7:21202864-21202886 GGAAAATGATTCTGGTGTACAGG + Intergenic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG + Intergenic
1038039056 8:23708688-23708710 GGTAAATTGTCTTGGTTTAGAGG - Intergenic
1038302044 8:26361011-26361033 GGCAAATATTCTTCGTGGACTGG - Exonic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG + Intergenic
1051730872 9:20141351-20141373 CACAAATGGTCTTGGAGTAAGGG - Intergenic
1053052952 9:34976756-34976778 GGCAAATGTTCCTGGGATACTGG + Intronic
1059468238 9:114483254-114483276 GGGATATGGTCTTGGTGCAGTGG + Intronic
1061968806 9:134032138-134032160 GCCATATGGTCTTTGAGTACGGG - Exonic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic
1199236290 X:145498118-145498140 TGCAGAGGGTTTTGGTGTACTGG + Intergenic