ID: 1040447630

View in Genome Browser
Species Human (GRCh38)
Location 8:47511692-47511714
Sequence GGCAAATGGTCTTGGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040447624_1040447630 -3 Left 1040447624 8:47511672-47511694 CCAAGGCCATAGCCATCTCCGGC 0: 1
1: 0
2: 0
3: 9
4: 193
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447620_1040447630 11 Left 1040447620 8:47511658-47511680 CCTCTGGTGCTGCCCCAAGGCCA 0: 1
1: 0
2: 5
3: 36
4: 264
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447625_1040447630 -9 Left 1040447625 8:47511678-47511700 CCATAGCCATCTCCGGCAAATGG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447622_1040447630 -2 Left 1040447622 8:47511671-47511693 CCCAAGGCCATAGCCATCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447621_1040447630 -1 Left 1040447621 8:47511670-47511692 CCCCAAGGCCATAGCCATCTCCG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81
1040447617_1040447630 29 Left 1040447617 8:47511640-47511662 CCACATAAGCAGACTCTTCCTCT 0: 1
1: 1
2: 1
3: 25
4: 292
Right 1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040447630 Original CRISPR GGCAAATGGTCTTGGTGTAC TGG Intronic