ID: 1040452323

View in Genome Browser
Species Human (GRCh38)
Location 8:47560486-47560508
Sequence ACTTATAAGCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040452323_1040452325 12 Left 1040452323 8:47560486-47560508 CCTTCCAGTTTCTGCTTATAAGT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1040452325 8:47560521-47560543 AGCACTCCACCAGAATCTCCTGG No data
1040452323_1040452329 23 Left 1040452323 8:47560486-47560508 CCTTCCAGTTTCTGCTTATAAGT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1040452329 8:47560532-47560554 AGAATCTCCTGGGTTTGCTCAGG No data
1040452323_1040452326 13 Left 1040452323 8:47560486-47560508 CCTTCCAGTTTCTGCTTATAAGT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1040452326 8:47560522-47560544 GCACTCCACCAGAATCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040452323 Original CRISPR ACTTATAAGCAGAAACTGGA AGG (reversed) Intronic
906279121 1:44541574-44541596 ACTTCTGAGCACTAACTGGAAGG + Intronic
907061232 1:51428040-51428062 ATTTCTCAGCAGAAACTTGAAGG + Intronic
907174168 1:52502396-52502418 ACTTTTAAGCTGTAACTTGAAGG - Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG + Intronic
910682981 1:89886357-89886379 ACTTCTAAGAAGAAACTTGGAGG - Intronic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
912034756 1:105299045-105299067 ACATATAAGCTGAAAATAGAAGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
916571524 1:166032372-166032394 ACCTACAGGCAGAAACTGGTTGG - Intergenic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
919111758 1:193228694-193228716 ACTTAAAAGCTGAAACTGTAAGG + Intronic
921405016 1:214769204-214769226 ACTGATGACCAGAAACAGGAGGG - Intergenic
924183077 1:241458737-241458759 ACGAATAAGCAGAAACTATAAGG + Intergenic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
924695177 1:246391984-246392006 GGTGATAAGCTGAAACTGGAGGG - Intronic
924742430 1:246802884-246802906 AATTATAACCACAAACAGGACGG + Intergenic
1064479420 10:15724675-15724697 ACTGATTAGTAGAAACTGGATGG + Intergenic
1064514924 10:16136681-16136703 ACTTATAAGTGGGAACTGAATGG - Intergenic
1064889954 10:20159852-20159874 ATTTTTCAGCAGAAACTCGAAGG - Intronic
1065527663 10:26639131-26639153 AGTTATAACCAGAACTTGGAGGG - Intergenic
1067034952 10:42907830-42907852 ACTGATAACCAGAATCTGCAAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1074026455 10:109640837-109640859 ACTTGTAAGTAGAAGCTGGCCGG - Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1080993502 11:37571315-37571337 ACTTAAGAGCTGAAACTTGATGG + Intergenic
1081362696 11:42199926-42199948 ACTTATAAGAAGGAACTTAATGG + Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1083094538 11:60236417-60236439 ACTCATATTCAGGAACTGGAAGG - Intronic
1083514722 11:63246299-63246321 ACTCCCAAGCAGAAACTGTATGG - Intronic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1085879839 11:80453637-80453659 ACAAATTAGCACAAACTGGATGG + Intergenic
1086299186 11:85406954-85406976 ACGTTTAAGCAGAAACCTGAAGG + Intronic
1088477873 11:110262708-110262730 AATTATAATCATAAACTAGAAGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092251961 12:6904560-6904582 ACTAATGAGCAGAAACTATAGGG + Intronic
1093456761 12:19372433-19372455 ACTAATATCCAGAATCTGGAAGG - Intronic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1094306862 12:29029711-29029733 AAGTATAAGAATAAACTGGATGG - Intergenic
1094789681 12:33897602-33897624 ACTAATAACCAGAATCTAGAAGG + Intergenic
1095519610 12:43047313-43047335 ACATATGAACTGAAACTGGAAGG + Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1095695900 12:45143826-45143848 ACTTATAAGAAGAGACTCCAGGG - Intergenic
1096087809 12:48877862-48877884 ACATATAAGTAGTAACTGGCAGG - Intergenic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1100340082 12:93670433-93670455 ACTTATCAGCAAAAATGGGAGGG + Intergenic
1102588983 12:113943095-113943117 ACACTTAAGCAGAAACTGAATGG - Intronic
1104431571 12:128720671-128720693 ACTTAAAAGAAAAAACTGGCCGG + Intergenic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1107494464 13:40912103-40912125 ACTTATCAACAGAAACAAGATGG + Intergenic
1107646141 13:42496115-42496137 ACTTTTGAGCAAAGACTGGAAGG - Intergenic
1107736780 13:43407056-43407078 AGTTATAATCATCAACTGGAAGG - Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108668686 13:52658867-52658889 ACTTATCAACAGAAACAAGATGG - Intronic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1110164987 13:72431053-72431075 ACTTGTAAGCAGAGGCTTGAAGG + Intergenic
1111281786 13:86035921-86035943 AGTTTTAAGCAGAAACTCTAGGG - Intergenic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1115129448 14:30037019-30037041 ACTTAAAAGAAGAAACTCAAGGG - Intronic
1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG + Intronic
1115751281 14:36493154-36493176 ACTGTTAAACAGAAAATGGAGGG - Intronic
1117317692 14:54589852-54589874 ACATATAAGCAGAGACCTGAAGG - Intronic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1121554676 14:94827419-94827441 ACTTATAGGCAGTAACTATAAGG + Intergenic
1123461948 15:20480629-20480651 ATTTATAAACAAATACTGGAGGG + Intergenic
1123656108 15:22519757-22519779 ATTTATAAACAAATACTGGAGGG - Intergenic
1124272634 15:28296612-28296634 ATTTATAAACAAATACTGGAGGG + Intronic
1124310018 15:28614929-28614951 ATTTATAAACAAATACTGGAGGG - Intergenic
1125514608 15:40310924-40310946 ACTTATTAGCAGACACTGACAGG + Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1128369645 15:67031138-67031160 ACATCTAAGCTGAAACTTGAAGG + Intergenic
1129112860 15:73348009-73348031 ACTTATAGGCTGACACTGGAGGG + Intronic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1138691568 16:58773730-58773752 ACTTATAACTAGAATCTGGTAGG + Intergenic
1138931118 16:61657148-61657170 ACTGATGATCAGAAATTGGATGG - Intronic
1139332952 16:66207996-66208018 ACTCATGAGCCGAAACTTGAAGG - Intergenic
1140319001 16:73929519-73929541 AGATATAAGCAGAAACTTTATGG - Intergenic
1141037155 16:80637556-80637578 ACTAATAAGCAAATACTGTAAGG + Intronic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1142419140 16:89959808-89959830 ACTTTTAAGCAAAAACTTGAAGG + Intronic
1142817580 17:2439051-2439073 ACTAAAAACCAGAAACTGGGAGG + Intronic
1143123380 17:4624210-4624232 ACTAATAAGCAGAAGCGGGGTGG - Intergenic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1146108517 17:30065003-30065025 ACAGATAAGCAAAAACTTGAGGG + Intronic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1150115160 17:62541093-62541115 AAATATAAGCAGAAACCAGAGGG - Intronic
1155433273 18:25784322-25784344 GCTTGAAACCAGAAACTGGAGGG + Intergenic
1155589659 18:27411889-27411911 ACATACAAACAGGAACTGGAAGG + Intergenic
1155629657 18:27877690-27877712 ACTTATAAGCTCATTCTGGATGG + Intergenic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156837894 18:41577128-41577150 ACTTAAGATCAGAAACTGAATGG + Intergenic
1157053828 18:44200843-44200865 ACTTATAAGCTCAAACTAAAGGG + Intergenic
1157378820 18:47192212-47192234 ACTAATAAGCAGCAACTGAGAGG - Intergenic
1158327901 18:56329972-56329994 ACTAATAACCACAAACTTGATGG - Intergenic
1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG + Intergenic
1159389316 18:67768269-67768291 AGTTATAAGCTAAAACTGGGAGG - Intergenic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1161875416 19:6904863-6904885 ACATTTAAGCAGAAACCTGAAGG + Intronic
1162660615 19:12165903-12165925 ACTTTTTAAAAGAAACTGGAAGG + Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1163077438 19:14907165-14907187 ACTTATTATGAGAAACAGGATGG + Intergenic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
1166563702 19:43750374-43750396 ACTTTTTAGCAGAGACTTGAAGG - Intronic
1167568527 19:50272257-50272279 ACTTAGAATCAGAAACAGAAGGG + Intronic
1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG + Intergenic
925542491 2:4980689-4980711 ACTGATAAGGAGGAGCTGGAGGG + Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
927823141 2:26286905-26286927 ATTTAAAAGCATAAACTGGCCGG + Intronic
928159801 2:28911923-28911945 ACTTATAAGAAGTAACAGCAGGG - Intronic
929352631 2:40976933-40976955 ATTTATAATAAAAAACTGGAGGG + Intergenic
932196002 2:69784631-69784653 ACCTAATAGCACAAACTGGATGG + Intronic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
935679006 2:105620078-105620100 AACTATCAGCAGAACCTGGACGG - Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
939629224 2:144514384-144514406 TCGTATAAGTAGAAGCTGGAAGG - Intronic
941014881 2:160344256-160344278 ACTTGTAAGCAGCAACTGGGGGG + Intronic
941191261 2:162385701-162385723 AGTTATTAGCAGAAACCAGATGG - Intronic
943679596 2:190754271-190754293 ATTTATAATCAGAAACTTGAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944641929 2:201736164-201736186 TCTTATAAGCAGCACATGGATGG - Intronic
946387768 2:219395624-219395646 AGTTATGACCTGAAACTGGAAGG - Intronic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
1168730096 20:69735-69757 ACTTATTAGGAAAAGCTGGATGG + Intergenic
1170396048 20:15926644-15926666 ACATTTAAGCAGTAACTTGAAGG + Intronic
1170837026 20:19893465-19893487 GCTTAGAAACACAAACTGGATGG - Intronic
1171357507 20:24560502-24560524 ACCCATAAGAAGTAACTGGATGG - Intronic
1174884708 20:54320768-54320790 TCTTATCAGCAGGAAATGGAGGG + Intergenic
1175001638 20:55635513-55635535 ACAAACAAACAGAAACTGGAGGG - Intergenic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1175829713 20:61956164-61956186 ACTAATAATCAGAATCTGCAAGG + Intronic
1181779142 22:25180242-25180264 ACTTTTAAGAAGAAACAGGCAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
949707961 3:6840573-6840595 CCTTATTACCAGAAACTGTAGGG + Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
953321511 3:41976579-41976601 ATTTAAAAGCAGAATCTGGCCGG + Intergenic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
963223011 3:142831718-142831740 ACTTATAAGCAGCAAAGGAAAGG + Intronic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
967473769 3:189892050-189892072 AGTTATAAGCAAAAACTGCAGGG + Intronic
970125047 4:12799766-12799788 ACTCTAAAGGAGAAACTGGAAGG - Intergenic
970568517 4:17356170-17356192 ACTTTTAAGCAGTAATGGGAAGG - Intergenic
970604403 4:17665899-17665921 ACTAAGAAGCAGCAACTGGGGGG - Intronic
970948299 4:21721560-21721582 ACTTATAAGCAAAAATTGAGTGG - Intronic
971012567 4:22454762-22454784 AATTATAAGTAGCAACTGTAGGG - Intronic
971583832 4:28378972-28378994 GCTTAGAAACAGAAACTGAATGG + Intronic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
974111503 4:57531366-57531388 ACTTATAATCAGACATTGGTGGG - Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975317364 4:72970002-72970024 ACTTATTGGCAGAAGCAGGAGGG + Intergenic
975670962 4:76780297-76780319 GCTTATAAAAACAAACTGGAAGG + Exonic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
979397931 4:120211223-120211245 ACGTATAAACTGATACTGGAAGG + Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
981397566 4:144271927-144271949 GCTTATAAGCCTAAAGTGGAAGG - Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
982881946 4:160731038-160731060 ATTAATAGTCAGAAACTGGACGG + Intergenic
983319083 4:166172421-166172443 ACAAAAATGCAGAAACTGGAAGG - Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
984519580 4:180785783-180785805 ACTTAAAAGCAGAAAATGAGGGG - Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
987185916 5:15419025-15419047 ACTTGTAAGAAGAAAATGAAAGG - Intergenic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
989031564 5:37124515-37124537 ACTTATGAACAGAAAATTGAAGG + Intronic
990517413 5:56543077-56543099 TCATATAAGCAGAACCTGGGAGG - Intronic
990879083 5:60520110-60520132 ACTTTTAAGAACACACTGGATGG + Intronic
991004053 5:61810564-61810586 AATTATAAGCAGAAACAGCTGGG + Intergenic
991038059 5:62147910-62147932 AATTATAAGCACAAAATCGAAGG - Intergenic
992211049 5:74479880-74479902 ACTTACAAGGAGAAACCAGAAGG + Intergenic
993841182 5:92880935-92880957 ACTGATAACCAGAAAATGGCTGG - Intergenic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
996044745 5:118858909-118858931 ACTTAAAAGAAGGAATTGGATGG - Intronic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
998896888 5:146809575-146809597 ACGTATCAGCTAAAACTGGAAGG + Intronic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999868149 5:155724129-155724151 AATTTTAAGCAAAAACTGGCAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003336145 6:5174697-5174719 ACTTATAATTGGTAACTGGAAGG + Intronic
1003402088 6:5799092-5799114 ACTTGGAAGCAGTGACTGGATGG - Intergenic
1006529212 6:34635926-34635948 AATCTTAAGAAGAAACTGGAAGG + Intronic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006704461 6:36006585-36006607 AAATATAAGTAGAAACTGGCAGG + Intronic
1006869520 6:37238553-37238575 ACATATAAGCAGAAACCTGCTGG + Intronic
1008797937 6:55327915-55327937 ACTTGTAAATAGATACTGGAAGG - Intronic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1009847058 6:69146971-69146993 ACTGATAAGCAGAAATTCAAAGG - Intronic
1012539111 6:100339880-100339902 AATTCTTAGCAGAAACTGAAGGG + Intergenic
1012986436 6:105881219-105881241 ACTTATATTAAGAAACCGGAGGG + Intergenic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1016713695 6:147201645-147201667 ATTTATGAGCATGAACTGGAGGG - Intergenic
1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG + Intergenic
1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG + Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023111296 7:36813533-36813555 ACCTTTAAGCAAAAACTTGAAGG - Intergenic
1023195722 7:37636561-37636583 ACTTATAAGTGGAAGCTGAATGG - Intergenic
1024186783 7:46957428-46957450 ACTCATGAGACGAAACTGGAAGG - Intergenic
1026446545 7:70489331-70489353 ACTTAACAGCGGACACTGGATGG - Intronic
1026497257 7:70913960-70913982 AGACATGAGCAGAAACTGGAAGG + Intergenic
1029112356 7:98219497-98219519 ACTCATAACCAGAATCTAGAAGG + Intronic
1031369048 7:120941687-120941709 ACTTATAAGCTATACCTGGATGG + Intergenic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1032044883 7:128596755-128596777 AAATATAAGCAGAAACCAGAGGG - Intergenic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1035819786 8:2579028-2579050 ACTCATGAGCAGAAGCTGAATGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1039117301 8:34105986-34106008 ACATATAAGCAGAAATATGAAGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041366668 8:57113808-57113830 ACTCATAAACATAAAATGGAGGG + Intergenic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1043553667 8:81404448-81404470 ACATTTAAGCAGAAACCAGAGGG + Intergenic
1043616778 8:82135160-82135182 ACTAATATTCAGAAACTGCAAGG + Intergenic
1045710628 8:104979346-104979368 CCTTATAAAAAGAAACTAGAGGG - Intronic
1045873945 8:106957257-106957279 ATTTATAAGAAAAAACTGGCTGG - Intergenic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1046720373 8:117612264-117612286 AGTTATAAGAGGAAACTGGGGGG + Intergenic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1048117188 8:131537564-131537586 ACTTAAAAGGAGAAGCTGGGGGG - Intergenic
1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG + Intronic
1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053728811 9:41031441-41031463 ACTAATAAGAAGAAAATGAATGG - Intergenic
1054699697 9:68400642-68400664 ACTAATAAGAAGAAAATGAATGG + Intronic
1055588414 9:77782856-77782878 ACTTATCAGGAGAAGCTAGATGG + Intronic
1055696091 9:78885985-78886007 ACTTACAAGAAGAAACTCAATGG - Intergenic
1056339446 9:85611039-85611061 ACTTATCATCAGAATCTGGAAGG + Intronic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1185959745 X:4536312-4536334 ACTTATCAGCTGATATTGGAGGG - Intergenic
1185983219 X:4802814-4802836 ACTACTAAGATGAAACTGGAAGG + Intergenic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1188691977 X:33140532-33140554 ACTGAGAATCAGAAAATGGAGGG - Intronic
1189634068 X:42986249-42986271 ACTTATAAGTAGAAGCTAAAGGG + Intergenic
1190600353 X:52086056-52086078 AGATATAATCAGAAACTGCAAGG - Intergenic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1195614020 X:106898637-106898659 ACTTACAAACAGAAACAGAATGG + Intronic
1196117254 X:112011188-112011210 ACATATAAGGAGAAATTGGGGGG - Intronic
1197113371 X:122802310-122802332 ACTCATAAGCAGAGAATAGAAGG + Intergenic
1197673677 X:129307318-129307340 ACATATAAGCTGAGACTTGAAGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199261205 X:145777885-145777907 TCTAATAAGCAGAAACTTTAGGG + Intergenic
1199515096 X:148667425-148667447 AGTTGTAAACAGCAACTGGATGG - Intronic
1200408982 Y:2843145-2843167 ACTTGGAAGCAGAAACTGACAGG - Intronic
1201694604 Y:16811162-16811184 ACTATTAAGATGAAACTGGAAGG - Intergenic