ID: 1040452326

View in Genome Browser
Species Human (GRCh38)
Location 8:47560522-47560544
Sequence GCACTCCACCAGAATCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040452323_1040452326 13 Left 1040452323 8:47560486-47560508 CCTTCCAGTTTCTGCTTATAAGT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1040452326 8:47560522-47560544 GCACTCCACCAGAATCTCCTGGG No data
1040452322_1040452326 22 Left 1040452322 8:47560477-47560499 CCTGAAAAGCCTTCCAGTTTCTG 0: 1
1: 0
2: 5
3: 39
4: 278
Right 1040452326 8:47560522-47560544 GCACTCCACCAGAATCTCCTGGG No data
1040452321_1040452326 23 Left 1040452321 8:47560476-47560498 CCCTGAAAAGCCTTCCAGTTTCT 0: 1
1: 0
2: 4
3: 35
4: 333
Right 1040452326 8:47560522-47560544 GCACTCCACCAGAATCTCCTGGG No data
1040452324_1040452326 9 Left 1040452324 8:47560490-47560512 CCAGTTTCTGCTTATAAGTTCAG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1040452326 8:47560522-47560544 GCACTCCACCAGAATCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040452326 Original CRISPR GCACTCCACCAGAATCTCCT GGG Intronic
No off target data available for this crispr