ID: 1040454755

View in Genome Browser
Species Human (GRCh38)
Location 8:47585690-47585712
Sequence CAGAGTCTCCACCAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 8, 1: 74, 2: 182, 3: 317, 4: 509}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040454755_1040454757 9 Left 1040454755 8:47585690-47585712 CCTTCTTGCTGGTGGAGACTCTG 0: 8
1: 74
2: 182
3: 317
4: 509
Right 1040454757 8:47585722-47585744 GAGATGGCACCACCATTACATGG No data
1040454755_1040454756 -7 Left 1040454755 8:47585690-47585712 CCTTCTTGCTGGTGGAGACTCTG 0: 8
1: 74
2: 182
3: 317
4: 509
Right 1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040454755 Original CRISPR CAGAGTCTCCACCAGCAAGA AGG (reversed) Intronic
900197366 1:1383370-1383392 CACAATGTCCACCAGCAAGAGGG + Intergenic
901023491 1:6267028-6267050 CAGATACTCCACCAGCTAGAGGG - Intronic
901532013 1:9859557-9859579 AAGAGTCTCAAATAGCAAGAGGG - Intronic
901904513 1:12396184-12396206 CAGACACTCCAGCAGCCAGAAGG - Intronic
902539126 1:17140073-17140095 GAGAGTCATCAGCAGCAAGAAGG - Intergenic
902753386 1:18533040-18533062 CAGTTTCCCCAACAGCAAGATGG - Intergenic
903016314 1:20364403-20364425 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
903797589 1:25941502-25941524 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
903963407 1:27071341-27071363 GCCTGTCTCCACCAGCAAGAGGG + Intergenic
904444152 1:30554168-30554190 GAGAGCCTGCACCAGCAAGAAGG - Intergenic
904478821 1:30781767-30781789 CAGAGTCCCCACCAGCAAGGAGG + Intergenic
904796667 1:33061408-33061430 GAGAGTCCCCACCAGCAGAAAGG + Intronic
904937138 1:34139358-34139380 GAGAGTCCCCACTAGCAAGAAGG + Intronic
904960842 1:34331714-34331736 CAGTGTTTCCATCAGCAAAATGG + Intergenic
905288695 1:36906343-36906365 CAGTTTCTCCACCTGCAAGATGG + Intronic
905602821 1:39268902-39268924 GAGAGTCTCCAAAAGGAAGACGG + Intronic
905934524 1:41812963-41812985 CTGAGACTCCTACAGCAAGAAGG + Intronic
906505151 1:46373499-46373521 GACAATCCCCACCAGCAAGAAGG - Intergenic
906617728 1:47246031-47246053 CAGAGTCCCTGACAGCAAGAAGG - Intergenic
906701681 1:47864202-47864224 CAGAATGTACACCACCAAGAGGG + Intronic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
907739556 1:57151501-57151523 GAGATTCTGCACCAGCCAGAGGG + Intronic
908075689 1:60515260-60515282 CAGAGTTCCCACGAGCAAGAAGG + Intergenic
908303925 1:62791538-62791560 CAGAATCCCCACCAGCAAGAAGG - Intronic
908700647 1:66896729-66896751 CAGAGTCCCCACTAGCAACAAGG + Intronic
908874490 1:68655719-68655741 TAGAGTTTCCACTGGCAAGAAGG - Intergenic
909139862 1:71849759-71849781 AAGATCCTCCACCAGCAAAAAGG + Intronic
909607716 1:77523289-77523311 CAGAGCTTCCATCAGCAAGATGG + Intronic
910041572 1:82858175-82858197 CAAAGTCTCAAGCAGCAGGATGG + Intergenic
910105605 1:83628337-83628359 CTGAGTCTCTAGTAGCAAGATGG - Intergenic
910226663 1:84942894-84942916 GAGACTCCCAACCAGCAAGAAGG + Intronic
910732824 1:90417136-90417158 AAGAGCCTCCACCAGCAAAAAGG + Intergenic
911408887 1:97476996-97477018 CAGACTTTCCACCAGCAGAAAGG - Intronic
912107784 1:106302926-106302948 GGGAGTCCCCAGCAGCAAGAAGG - Intergenic
912464212 1:109858787-109858809 CAGAAACTCCACAAGCCAGAAGG + Intergenic
912576014 1:110673907-110673929 CAGCGTCTCCACCACGAAGAAGG + Exonic
912708249 1:111930747-111930769 CAGTTTCTCCTCCAGCAACATGG + Intronic
913000649 1:114577278-114577300 CCAAGTCCACACCAGCAAGAAGG + Intronic
913529601 1:119724373-119724395 CAGATCCTCCTCCAGCAGGAGGG - Intronic
913682810 1:121202940-121202962 GAGAGTTCCCATCAGCAAGAAGG - Intronic
914034652 1:143990565-143990587 GAGAGTTCCCATCAGCAAGAAGG - Intergenic
914154800 1:145077403-145077425 GAGAGTTCCCATCAGCAAGAAGG + Intronic
914919331 1:151837128-151837150 AAGAGCCTCCTCCAGCCAGAAGG - Intergenic
914985173 1:152450090-152450112 CAGTGGCACCACCAGCAAGAAGG - Intergenic
915155608 1:153873568-153873590 CAAGGTCCCCACCAGCAAGAAGG + Intronic
915658749 1:157383360-157383382 CAGAATCCCCACCAGCAAGAAGG + Intergenic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
916217704 1:162411649-162411671 CAGACTCTGCAGCAGCAGGAGGG - Intronic
916379241 1:164189927-164189949 GAGAGTCTCCATCAGCAAGAAGG - Intergenic
916782823 1:168054275-168054297 CAGAGTCCTTGCCAGCAAGAAGG - Intronic
916788915 1:168107526-168107548 CAGCGTCCCCACCAACAAGAAGG + Intronic
917075218 1:171197859-171197881 CAGAGTCCAAACCAGCAAGAAGG + Intronic
917110640 1:171543844-171543866 CAGAGTCTCTACCAACAAGAAGG - Intronic
917152714 1:171961988-171962010 GAGAGCCCCCACCAGTAAGAAGG - Intronic
917362272 1:174189995-174190017 GAGAGTCCCCACCTGAAAGAAGG + Intronic
917953142 1:180062634-180062656 GAGAGTCCCTACCAGCAAGAAGG - Intronic
918413922 1:184287963-184287985 CTGAGTCTGCACCATAAAGAAGG + Intergenic
918545904 1:185683644-185683666 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
918632399 1:186733316-186733338 AAGACCCTCCACCAGCAAAAAGG - Intergenic
918739111 1:188104461-188104483 TGCAGTCTCCATCAGCAAGAAGG - Intergenic
919102143 1:193108091-193108113 CAGAGTTCCCACCAGCAAGAAGG + Intergenic
919132443 1:193468429-193468451 CTGAGTCTCCACTTCCAAGATGG + Intergenic
919211459 1:194492517-194492539 AAGAGTCCTCACCAGCAAGAAGG - Intergenic
919510480 1:198457278-198457300 CAGAATCCCCACCAGCAAGAAGG - Intergenic
919784346 1:201249881-201249903 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
920571111 1:207018629-207018651 CAGAGTCTTCACCTATAAGACGG - Exonic
920790318 1:209083859-209083881 GAGAGTTGCCACCAGCAAGAAGG - Intergenic
920956483 1:210624243-210624265 GAGAGTTCCCACCAGCAAGAAGG + Intronic
921257349 1:213354613-213354635 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
921306798 1:213805133-213805155 AAGACCCTCCACCAGCAAAAAGG - Intergenic
921701627 1:218274980-218275002 GAGAGTTCCCACCAGCATGAAGG + Intergenic
921815351 1:219557247-219557269 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
922032603 1:221816757-221816779 AATACTCTCCACCAGCAAAAAGG + Intergenic
922163032 1:223092320-223092342 CACATTCTCCACCACCACGATGG - Intergenic
922737527 1:227995652-227995674 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
922760884 1:228129801-228129823 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
922761134 1:228131511-228131533 GGGAGTCCCCACCAGCAAGAAGG - Intergenic
922778166 1:228227089-228227111 CAGTGTCTACACCACCAAGCTGG - Intronic
923103191 1:230833827-230833849 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923262192 1:232278138-232278160 GACAGTCCCCACCAGCAAGAAGG - Intergenic
923268980 1:232337712-232337734 CAGGATCCCCACTAGCAAGAAGG + Intergenic
923316889 1:232789163-232789185 TAAAGTCCCCACCAGGAAGAAGG - Intergenic
923441456 1:234024551-234024573 CAGAGTCCCCAACAGCAAAAGGG - Intronic
923544239 1:234912774-234912796 GAGAGTTCCCAGCAGCAAGAAGG + Intergenic
923556349 1:235003666-235003688 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
923615152 1:235531167-235531189 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
923718056 1:236443115-236443137 TAGAGTCCCCACCGGCAAGAAGG + Intronic
923774934 1:236969693-236969715 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
923774959 1:236969827-236969849 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
923967721 1:239160045-239160067 CAGAGACCGCACCAACAAGAGGG + Intergenic
924118120 1:240767715-240767737 GAGAGTCCCCACCGGCAAGAAGG - Intergenic
924429050 1:243980783-243980805 AAGAGTTCCCACTAGCAAGAAGG + Intergenic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
924623766 1:245684247-245684269 CAGAGACTCCCGCAGCAACATGG - Exonic
924643640 1:245857248-245857270 CAGAGGCTCCACCAGCCAGGCGG - Intronic
924791780 1:247257281-247257303 CAGAATTCCCACCAGCAAGAAGG + Intergenic
924793760 1:247277256-247277278 CAGAGTCTCCACTAGAAAGAAGG - Intergenic
1063149390 10:3322705-3322727 GAGAGCCCCCACCAGTAAGAGGG + Intergenic
1063175738 10:3549377-3549399 CACAGTTACCACCAGCAAGAAGG + Intergenic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063825921 10:9897327-9897349 GGGAGTCCCTACCAGCAAGAAGG - Intergenic
1063960862 10:11304510-11304532 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1064472474 10:15650538-15650560 GAGGGTCCCCACCAGCAAGAAGG + Intronic
1065492267 10:26293882-26293904 CAGTTTCTCCATCAGCAAGATGG - Intronic
1065771783 10:29084808-29084830 CAGACTCCCTACCAGCAAGAAGG + Intergenic
1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG + Intronic
1066282354 10:33930218-33930240 GAGAGTCTGCATCAGCAAGAAGG - Intergenic
1066417304 10:35233147-35233169 CGCAGTCTCCACCAGCAAGAAGG + Intergenic
1066651083 10:37655767-37655789 CAGAGACTCTACAAGCTAGAAGG - Intergenic
1067045763 10:42984389-42984411 CAGTGTCTTCACCTGTAAGATGG - Intergenic
1067492757 10:46727578-46727600 GAGAGTCCCCACAAGCAAGAAGG - Intergenic
1067601908 10:47612817-47612839 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1067733804 10:48833504-48833526 CAGTGTCACCTCCATCAAGATGG + Intronic
1067939909 10:50646553-50646575 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1068249951 10:54425402-54425424 GAGAGTCCCCACAAGCAAGAAGG + Intronic
1068279340 10:54848536-54848558 AAGAGACCCCACCAGCAAGAAGG + Intronic
1068343683 10:55742395-55742417 CAGAGTTCTCATCAGCAAGAAGG - Intergenic
1068379346 10:56229744-56229766 GAGAGTCCCTTCCAGCAAGAAGG - Intergenic
1068543329 10:58320390-58320412 GAGTGTCCCCACCAGCAAGAAGG - Intergenic
1068733215 10:60383379-60383401 CAGGCTCTCCACCTGCAAAATGG - Intronic
1068924423 10:62520525-62520547 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1069079811 10:64076611-64076633 CAGAGTCTAAATCAGCAAAAGGG - Intergenic
1069171667 10:65238600-65238622 TAGAGTCCTCACCAGCAAGAAGG - Intergenic
1069592026 10:69648063-69648085 CACACTCCCCACCAGCAAAAGGG - Intergenic
1069600467 10:69702672-69702694 CAGAGAGCCCACCAGCAAGGAGG + Intergenic
1069887444 10:71632958-71632980 GAGAGCCCCCACCAGCAAGAGGG - Intronic
1070029879 10:72666720-72666742 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1070081572 10:73193918-73193940 GAGAATCCCCACCAGCAAGAAGG - Intronic
1070202716 10:74223165-74223187 TAGAGTCACTATCAGCAAGAAGG - Intronic
1070974118 10:80591419-80591441 AAGAGTCGCCACTAGCAAGAAGG - Intronic
1071230795 10:83582283-83582305 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071653434 10:87420405-87420427 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1071957817 10:90778447-90778469 CAGAGTCCCTACCAGCAAGAAGG + Intronic
1072001665 10:91201234-91201256 GAGGGTCTCCACCGGCAAGAAGG - Intronic
1072105087 10:92266082-92266104 TGCAGTCTCCACCAGCAAGAAGG + Intronic
1072159048 10:92749427-92749449 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1072341645 10:94458326-94458348 GAGCGTCCCCATCAGCAAGAGGG + Intronic
1072469336 10:95697693-95697715 GAGAGTTGCCAGCAGCAAGAAGG + Intergenic
1072483291 10:95830011-95830033 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1072652152 10:97304077-97304099 CAGAGTCTCCATCAGCAAGAAGG + Intergenic
1074136494 10:110631776-110631798 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1074141450 10:110677095-110677117 CAGAGTTCCCACCAGCAAGAAGG - Intronic
1074416140 10:113268596-113268618 CAGTGTCTCCTCCAGAAAGGGGG + Intergenic
1074465606 10:113679190-113679212 CAGCATCTCCACCAGCAAGCTGG + Intronic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075282384 10:121150712-121150734 GTGAGTCCCCAACAGCAAGAAGG + Intergenic
1075398775 10:122146609-122146631 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1075647204 10:124104454-124104476 CACAGGCTCCACCAGCACGTCGG + Intergenic
1075733403 10:124649650-124649672 CAGAGTGTCCCCCTGTAAGATGG + Intronic
1075857838 10:125645488-125645510 GAGAGTCCTCACTAGCAAGAAGG + Intronic
1076229708 10:128809850-128809872 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1076242123 10:128916498-128916520 CATAGCCTTCAGCAGCAAGAAGG + Intergenic
1076451034 10:130557130-130557152 CAGAGTCCTCACCAGCGAAAAGG + Intergenic
1076468873 10:130704644-130704666 CAGAGTCCCCGCCAGCAGGAAGG + Intergenic
1076469170 10:130706718-130706740 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1076803265 10:132842756-132842778 CAGAGGCCCCACCTGCAAGAAGG - Intronic
1077521047 11:3034922-3034944 AAAAGTCCCCACCAGCAAGAAGG - Intronic
1077540090 11:3142601-3142623 CAGGCTCTCCACCCGCGAGACGG - Intronic
1078571849 11:12465301-12465323 GAGAGTCCCCACCAGCACAAAGG + Intronic
1078646243 11:13143351-13143373 CAGAGTCCCCACCTGGAAAATGG + Intergenic
1079135168 11:17772329-17772351 CAGAGCCCCCACCAGCATGCCGG - Exonic
1079407688 11:20160193-20160215 CAGATCCTCCACCAGGAAGCTGG + Exonic
1079459072 11:20663966-20663988 TAGAGTCCCCACTAGCAAGAAGG - Intergenic
1079519835 11:21313657-21313679 GTGAGCCCCCACCAGCAAGAAGG - Intronic
1079685766 11:23357683-23357705 CAGAGTTCCCACCAGCAAGAAGG - Intergenic
1079960111 11:26913598-26913620 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1079996138 11:27297026-27297048 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1080144117 11:28958955-28958977 GAGAGCCCTCACCAGCAAGAAGG + Intergenic
1081303673 11:41485062-41485084 CAAAGTTTCCACCAGCAAGAAGG - Intergenic
1081407225 11:42711540-42711562 GAGAGTCCTCACCAGCAAGCAGG + Intergenic
1081412964 11:42781772-42781794 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1082872779 11:57958895-57958917 GAGTGTCCCCATCAGCAAGAAGG + Intergenic
1082914023 11:58411378-58411400 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
1083016308 11:59457685-59457707 AAGAGTCACCACCAGCATGTGGG - Exonic
1083176104 11:60951420-60951442 CAGCATCTCCACCAGCAGCACGG + Exonic
1083362248 11:62118583-62118605 GATAGTCCCCATCAGCAAGAAGG - Intergenic
1083549101 11:63572569-63572591 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1083611546 11:64006803-64006825 CAGTTTCTCCACCTGCAAAATGG + Intronic
1083616655 11:64029576-64029598 CAGACTCTGCACCATCCAGAAGG + Intronic
1083882501 11:65555456-65555478 CAGTGTCTCCACCAGGAGGGAGG + Intronic
1084025755 11:66448225-66448247 GAGAGTCCTCATCAGCAAGAGGG - Intronic
1084039855 11:66536130-66536152 CAGTGTCTCCCCCACCAGGAAGG + Intronic
1084497974 11:69516342-69516364 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1085164484 11:74384864-74384886 CAGGGTCTCCACCCGCAATAGGG + Intronic
1085326416 11:75610108-75610130 CAGGGTCCCCACCAACAAAAAGG + Intronic
1085800039 11:79580831-79580853 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
1086576159 11:88341103-88341125 AAGAGTCTCAACCAGCAAGAAGG - Intergenic
1087285555 11:96261277-96261299 CAGAATCCCCACCACCAAGAAGG + Intronic
1088052606 11:105536207-105536229 TAGAGTCCCCTTCAGCAAGAAGG - Intergenic
1088177401 11:107069296-107069318 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1089904820 11:122027804-122027826 CAGGGTCCCCCCCAGCAAGAAGG - Intergenic
1090033009 11:123223459-123223481 CAGGGTCCCCATCAGCAAGAGGG + Intergenic
1090046850 11:123343292-123343314 GAAAGTCTCTGCCAGCAAGAAGG + Intergenic
1090535465 11:127636440-127636462 CAGAGTCCCCACCCTCAAGAAGG + Intergenic
1090544075 11:127743404-127743426 TAGAGTCCCCACCAGCAAGAAGG - Intergenic
1090737924 11:129627826-129627848 AAGACCCTCCACCAGCAATAAGG - Intergenic
1090824587 11:130375426-130375448 CAGAGTCTCCCAGAGCACGAAGG - Intergenic
1091111051 11:132968361-132968383 CAGAGGCCCCACCAGCAAGAAGG - Intronic
1091747273 12:3000380-3000402 CAGAGTTCCCTCCAGCACGAAGG - Intronic
1091974081 12:4810826-4810848 CAGCGTCTCCACCAGAAAGAAGG - Exonic
1092023441 12:5221681-5221703 CTCAGTGTCCACCAGCCAGAGGG - Intergenic
1092443331 12:8528347-8528369 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1093163790 12:15781787-15781809 GAGAGTCCCCACCAGCAAGGAGG - Intronic
1093526084 12:20104669-20104691 CAGAGTCCTTACCAACAAGACGG - Intergenic
1094649268 12:32359384-32359406 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1094741515 12:33294912-33294934 GAGAGTCTCCAACAGCAAGAAGG + Intergenic
1095326120 12:40895443-40895465 CGGAGTCCCCACCAGCAAGGAGG - Intronic
1095342097 12:41102695-41102717 CAGAATCTTCATCAGCATGATGG + Intergenic
1095748609 12:45686927-45686949 CAGAGTCCTCATCAGCAAGAAGG - Intergenic
1097074850 12:56385299-56385321 TAGAGTCCCCACCATGAAGAAGG + Intergenic
1097381941 12:58905799-58905821 CAGAGTCCCCACCAGCAAAAAGG + Intronic
1098034964 12:66292588-66292610 CTGTTGCTCCACCAGCAAGAAGG - Intergenic
1098175629 12:67787451-67787473 TAGAGTCCCCTCCAGCAGGAAGG + Intergenic
1098432366 12:70433897-70433919 AAAAGTCTGCACCAGCAAGCAGG - Exonic
1098673824 12:73264767-73264789 GAGAGTCCCCTCCAGCAAGAAGG - Intergenic
1098688729 12:73459418-73459440 CAGAGTTCCCCCTAGCAAGAAGG - Intergenic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099044265 12:77696294-77696316 AAGAGACTCTACTAGCAAGACGG - Intergenic
1099393784 12:82112807-82112829 AAGACTCTCCACTAGCAAAAGGG + Intergenic
1099994834 12:89767265-89767287 GAGAGTCCCTACCAGCAGGAAGG + Intergenic
1099996895 12:89787850-89787872 GAGAGTCCCCTCCAGCAACAAGG - Intergenic
1100024711 12:90113907-90113929 GAGAGTCCCCACAAGCAAGAAGG - Intergenic
1100965082 12:100004346-100004368 CTGAGTCCCCACCAGTAAGAAGG + Intergenic
1101104849 12:101429586-101429608 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1101289963 12:103358119-103358141 AAGGGTTTCCATCAGCAAGAGGG + Intronic
1101940292 12:109094833-109094855 CAGAGTCCCCACCAGCAAGAGGG + Intergenic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102259707 12:111436576-111436598 CAGAGTCCCCAGCAGCAACATGG - Intronic
1102401509 12:112633577-112633599 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1102732631 12:115126364-115126386 CAGAGTCCCCCACAGCAAGAAGG - Intergenic
1104511370 12:129382460-129382482 CTGAGGATCCTCCAGCAAGATGG + Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104588721 12:130067685-130067707 TAGAGGCCCCACCAGCAGGAAGG - Intergenic
1104648955 12:130517293-130517315 CAGAGTCCTCATCAGCAAGAAGG + Intronic
1104969986 12:132526860-132526882 CAGGGCCTCCCCCAGCAGGAGGG - Intronic
1105352066 13:19624928-19624950 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1105788155 13:23769985-23770007 CGGCGTCCCCACCAGCAGGAGGG + Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1106146235 13:27052401-27052423 CTGAGTCCCTGCCAGCAAGAAGG + Intergenic
1106194362 13:27480670-27480692 GAGAATCCCCACCAGCAGGAAGG + Intergenic
1106698091 13:32199978-32200000 GAGAGTCCCCATCAGCAAGAAGG - Intronic
1106733199 13:32563142-32563164 GGGATTCTCCACCAGGAAGATGG - Intergenic
1106873000 13:34042170-34042192 CAGAGTCCACACCACCAAGGAGG + Intergenic
1106994094 13:35460896-35460918 GAGAGTCCCTACCAGCAAGAAGG - Intronic
1107161450 13:37233534-37233556 CAGAGTCTCCACCATCAAGAAGG + Intergenic
1107193686 13:37621602-37621624 CAGAATCCCCACCAGCAAAAAGG + Intergenic
1107474306 13:40720552-40720574 GAGAGTCCCCACCAGCAAGGAGG - Intergenic
1108268382 13:48734496-48734518 CAGTGTCTTCACCAGTAAGATGG - Intergenic
1108458731 13:50643725-50643747 GAGAGTCCCCACCAGCAGGAAGG - Intronic
1108516463 13:51207753-51207775 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1108909151 13:55520727-55520749 AAGACTCTCCACCAGCAAAAAGG - Intergenic
1108984022 13:56559769-56559791 GAGAGTTTCCACCAGTAAGAAGG + Intergenic
1109892377 13:68632002-68632024 CAGAGTCCCCACCAAGAAGAAGG - Intergenic
1109939442 13:69342109-69342131 TACAGTCTCCACCAGAGAGAAGG - Intergenic
1110354342 13:74549836-74549858 CAGCGTCTCCCCCAGCAAGAAGG + Intergenic
1110560674 13:76908040-76908062 CAGAGGCTGCAACAGCAACATGG + Intergenic
1110870798 13:80450547-80450569 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1111123818 13:83887405-83887427 CAGAGTTCCTGCCAGCAAGAAGG - Intergenic
1111283978 13:86064223-86064245 AAGAGTCCCCACCAGCAAGAAGG + Intergenic
1111324135 13:86669172-86669194 AAAACTCTCCACCAGCAAAATGG - Intergenic
1111679133 13:91422715-91422737 CAGAGTCCCCACCAGCAGGAAGG - Intronic
1112266799 13:97931874-97931896 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1113087416 13:106582440-106582462 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1113484813 13:110646071-110646093 CAGGCTCTCCAGCACCAAGAGGG - Exonic
1113572615 13:111369613-111369635 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1113863561 13:113506919-113506941 CCGAGTCTACACCACCAAGCAGG - Intronic
1114177395 14:20335278-20335300 GCGAGTCCCCTCCAGCAAGAAGG + Intergenic
1114929159 14:27445797-27445819 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1115753847 14:36514983-36515005 CACAGTTTCCAACAGCCAGAGGG - Intergenic
1116441080 14:44953611-44953633 CAGAGTTCTTACCAGCAAGAAGG + Intronic
1116943431 14:50812966-50812988 CAGTGTCTACACTTGCAAGAAGG - Intronic
1117067547 14:52025610-52025632 GAGAGTCCCAACCAGCAGGAAGG - Intronic
1117714544 14:58567140-58567162 GAGAGTCACCACCAACCAGAAGG - Intergenic
1118595792 14:67434856-67434878 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
1118965784 14:70583876-70583898 CAGACTTCCTACCAGCAAGAAGG + Intronic
1119093350 14:71805410-71805432 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1119536433 14:75406562-75406584 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1120400183 14:84021602-84021624 CAGAAACTCCACAAGCTAGAAGG - Intergenic
1120480338 14:85041359-85041381 GAGAGCTTCCACCAGCAAGAAGG + Intergenic
1120552787 14:85891774-85891796 GAGACTCCCCACCAGCAAGAAGG - Intergenic
1120564640 14:86039367-86039389 GAGAGTTCTCACCAGCAAGAAGG + Intergenic
1120690604 14:87588579-87588601 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1120749288 14:88182973-88182995 TGGAATCTCCACCACCAAGAGGG - Intronic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1121182211 14:91937702-91937724 GAGAGCCCCCACCAGCAAGAAGG + Intronic
1121372852 14:93376005-93376027 GAAAGTCCCCACCAGCAAGAAGG + Intronic
1121571181 14:94947614-94947636 AAGAGTCCTCACCAGCAAGAAGG + Intergenic
1121685292 14:95831138-95831160 CAGCATCTCCACCAGCAAGCAGG - Intergenic
1121753116 14:96375799-96375821 CAGAGTCCCCACCGCCAAGAAGG - Intronic
1121814702 14:96920382-96920404 CAGTGAGGCCACCAGCAAGAGGG + Intronic
1121900136 14:97686409-97686431 CAGAGTTCCCAGCAGCAAGAAGG - Intergenic
1122086212 14:99307716-99307738 GAAAGTCTGCACCAGCAAGAAGG - Intergenic
1122220310 14:100234409-100234431 CAAAGACTCCACAACCAAGAAGG + Intergenic
1122725251 14:103746336-103746358 CAAACTCTCCCCCAGGAAGAGGG + Intronic
1122866562 14:104607665-104607687 GGGAGTTTCCACCAGCAAGAAGG + Intergenic
1123220086 14:106847237-106847259 CAGAAACTTCACCAGCCAGATGG - Intergenic
1124055779 15:26239735-26239757 CAGAGTTTCCAATAGCTAGAAGG - Intergenic
1124615593 15:31239566-31239588 ACGGGTCCCCACCAGCAAGAAGG - Intergenic
1124686360 15:31786128-31786150 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1124823299 15:33068806-33068828 CCCAGTGTCCACCAGCAACAGGG + Intronic
1125548645 15:40527774-40527796 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1125564784 15:40668298-40668320 CAGAGTCCCTATCAGCAAGAAGG + Intergenic
1125909677 15:43425078-43425100 CAGAGTCCCCTCCAGCAAGAAGG + Intronic
1125975082 15:43944191-43944213 TAGAGTTCCCACCAGCAAGAAGG - Intronic
1126391826 15:48164743-48164765 AAGACTCTCCACCAGCAAAAAGG + Intronic
1126935973 15:53708189-53708211 AAGAGTCTCCACCACCCAGGAGG + Intronic
1127208717 15:56748535-56748557 AAGAGTCCCAACCAGCAAAAAGG - Intronic
1127244691 15:57159416-57159438 CAGGTTCTCCACGAGCAAAAAGG + Intronic
1127765103 15:62178112-62178134 GAGAATCCCCACCAGCAAGAAGG + Intergenic
1127920447 15:63490334-63490356 GAGAGTTCCCACCAGCAAAAAGG + Intergenic
1127973634 15:63981280-63981302 GAGAGTCCCCATTAGCAAGAAGG + Intronic
1128086854 15:64892704-64892726 CAGAGTCCCCACCACCAAGAAGG + Intronic
1128475738 15:67995615-67995637 CAGTGTCACTACCAGCAAGGAGG - Intergenic
1128908573 15:71491500-71491522 GAGAGTCTGCATCAGCAGGAAGG + Intronic
1129582570 15:76828124-76828146 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1129949964 15:79577018-79577040 AAGAGTCCCCATGAGCAAGAAGG - Intergenic
1129990235 15:79955570-79955592 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1130025339 15:80266347-80266369 CTGAGGCTCCACCAGCCAGAAGG - Intergenic
1130557570 15:84933555-84933577 CAGAATCCCCAGCAGCAAGAAGG - Intronic
1130925453 15:88382485-88382507 CACAGGCTCCAGCAGCAAGGAGG + Intergenic
1130929063 15:88408650-88408672 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1131086481 15:89579806-89579828 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1131105826 15:89733709-89733731 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1131262212 15:90893327-90893349 CAGAGTCTTCACCCGCAGGCGGG - Exonic
1132024753 15:98395581-98395603 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1132496460 16:265655-265677 AAGGGTCTCCCCCAGCAGGATGG + Exonic
1133113778 16:3564649-3564671 CAGGCCCTCCACCAGCAGGAGGG + Exonic
1133119606 16:3597947-3597969 GAGAGGACCCACCAGCAAGAAGG - Exonic
1133809405 16:9149501-9149523 GAGAGACCCCACCAGCAAGAAGG - Intergenic
1133872111 16:9698660-9698682 CAGAGTTCCCATCAGCAAGAAGG - Intergenic
1134017212 16:10897231-10897253 GAGAGTCCTCACCAGTAAGAAGG - Intronic
1134067683 16:11239710-11239732 CTGAGTCCCCACCAGCAAGAAGG - Intergenic
1134189341 16:12109227-12109249 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1134275829 16:12775209-12775231 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1135037879 16:19093406-19093428 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1135145823 16:19961951-19961973 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
1135204810 16:20474450-20474472 CGGAGTCCCCAACAGCAAGAAGG + Intronic
1135214087 16:20549363-20549385 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1135419664 16:22297421-22297443 GAGTTTCTCCACCAGCAACATGG + Exonic
1135490909 16:22908547-22908569 GAGAGCCCCCAACAGCAAGAAGG - Intronic
1135494772 16:22941795-22941817 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1135606384 16:23828696-23828718 GAGAGTCCTCACCAACAAGAAGG - Intergenic
1136055162 16:27682955-27682977 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1136514927 16:30762350-30762372 CAGAGCCCTCACCAGCAGGAGGG - Exonic
1137253133 16:46754572-46754594 GAGAGGGCCCACCAGCAAGAAGG + Intronic
1137285453 16:47012562-47012584 GAGAGTCCTCACTAGCAAGAAGG - Intergenic
1137668860 16:50267576-50267598 CACAGCCTCCATCTGCAAGATGG - Intronic
1137984545 16:53096803-53096825 GAGAGTCCCCTCAAGCAAGAAGG - Intronic
1138115438 16:54357227-54357249 CAGCTTCTCCACCTGCAAAATGG + Intergenic
1138301121 16:55930558-55930580 GAGAGTCCCCACCAGCAAGAAGG + Intronic
1138301337 16:55932236-55932258 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1138323650 16:56142033-56142055 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1138357033 16:56390445-56390467 CAGAGTCTCCAGCAACTAAATGG + Intronic
1138493312 16:57390882-57390904 CAGAGGCCCCATCAGCAAGATGG + Intergenic
1138745186 16:59355025-59355047 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1138855837 16:60690188-60690210 TAGAGTCCGCATCAGCAAGAAGG - Intergenic
1139012572 16:62650190-62650212 GAGAGTCACCAACAGCAAGAAGG - Intergenic
1139127004 16:64090082-64090104 GAGATTCTCCACCAGCAAGAAGG + Intergenic
1139345388 16:66299867-66299889 GAGGGTCCCCACCAGCAAGAAGG - Intergenic
1139819202 16:69707110-69707132 GGGAGTCCTCACCAGCAAGAAGG - Intronic
1140029403 16:71323076-71323098 CAGATACTCCACCACCAAGGAGG + Intergenic
1141439680 16:84021851-84021873 CAAAGTCCCCTCCGGCAAGAAGG - Intronic
1141586411 16:85036584-85036606 CAAAGGCTCCATCTGCAAGAGGG - Intronic
1141597342 16:85105363-85105385 CACAGTCTCCTCCAGCTGGAGGG + Exonic
1141863763 16:86735820-86735842 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1141863786 16:86735929-86735951 CAGAGTCCCCACCAACAGGAAGG - Intergenic
1141873930 16:86808672-86808694 CAGAGTTGCCACCTGCAAAATGG + Intergenic
1141899087 16:86978689-86978711 CAGGATCTGCTCCAGCAAGAAGG + Intergenic
1142113329 16:88343605-88343627 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1143326462 17:6101619-6101641 CTGACTCTCTGCCAGCAAGAGGG + Intronic
1144076379 17:11723231-11723253 CAGATTCCCCACCATCAGGAAGG + Intronic
1144344393 17:14336935-14336957 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1144586163 17:16489177-16489199 CCGAGTCCCCACCAGCCATATGG + Intronic
1144711644 17:17405209-17405231 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1144957529 17:19026653-19026675 CAGAGTGTCCTCCAGCTAGAGGG + Intronic
1144977627 17:19147863-19147885 CAGAGTGTCCTCCAGCTAGAGGG - Intronic
1145092318 17:19996113-19996135 GAGAGTCCCCACCAACAAGAAGG - Intergenic
1146359976 17:32166335-32166357 AAGACTCTCCACCAGCAAAAAGG - Intronic
1146670965 17:34737340-34737362 CACAGTCCCTACCAGCAAGAAGG - Intergenic
1146685764 17:34840674-34840696 CAGTTTCTCCACCTGCAAAATGG - Intergenic
1147748454 17:42710972-42710994 CAGAGTCTCCTCCAGAAGGTAGG + Intronic
1148966589 17:51441049-51441071 GAAAGTCACCACCAGCAAGAAGG - Intergenic
1149632647 17:58139638-58139660 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1150032384 17:61753177-61753199 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1150164096 17:62924931-62924953 CAGTGTCTGAACCAGTAAGAGGG + Intergenic
1150837082 17:68574042-68574064 GAGAGTTCCCACCACCAAGAAGG - Intronic
1150849300 17:68689209-68689231 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1151280205 17:73068286-73068308 CGGAGTCTCTCCAAGCAAGATGG - Intronic
1151286367 17:73114455-73114477 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1151480427 17:74367355-74367377 AAGAATCGCCACCACCAAGAAGG + Intergenic
1151550962 17:74822263-74822285 CAGGGTCTCCAACAGCAGAATGG - Intronic
1151793503 17:76325557-76325579 AAGACCCTCCACCAACAAGATGG + Intronic
1153185086 18:2477499-2477521 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1153237345 18:3000697-3000719 CAGAGTCTCCGCAGGCCAGAGGG - Intronic
1153725041 18:7945485-7945507 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1153916853 18:9753439-9753461 CAGAGTCCTCACCAGCAGGAAGG + Intronic
1154091993 18:11373759-11373781 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1154094847 18:11403403-11403425 CAGAGTCCTCACCAGCAAAAAGG + Intergenic
1155493370 18:26420872-26420894 CAGCATCCCCACTAGCAAGAGGG + Intergenic
1155853044 18:30796536-30796558 GAGAGTCCCCACCAGGAAGAAGG - Intergenic
1156164891 18:34406581-34406603 GAGAGTCCCCAACAGCAAGAAGG + Intergenic
1156253163 18:35371518-35371540 GAGGGTCTCCACCAGCAAGAAGG - Intronic
1156976066 18:43222583-43222605 GAGGGTCTCCATTAGCAAGAAGG - Intergenic
1157023724 18:43817448-43817470 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
1157248682 18:46074661-46074683 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
1157636563 18:49162353-49162375 GAGAGTCACCACTAGCAAGAAGG - Intronic
1157664554 18:49474902-49474924 CAGAGTCCTTACCAGCAAGAGGG - Intergenic
1157806055 18:50658408-50658430 CAGATTCTTCACCTGCCAGAGGG + Intronic
1157812627 18:50708600-50708622 TAGGGTCTCCACCAGGAAGACGG + Intronic
1157872907 18:51246801-51246823 CAGAGTCCTCATCAGCAGGAAGG + Intergenic
1158488654 18:57890637-57890659 GCCAGTCTCCACCATCAAGAAGG - Intergenic
1158564492 18:58543189-58543211 GAGAGTCCCCAGCAGCAATAAGG + Intronic
1158903435 18:61987549-61987571 AAGAGTCTCCACCTGTAAGAAGG + Intergenic
1159374868 18:67580199-67580221 CAGAATCCCCGCCAGCAGGAAGG + Intergenic
1160165259 18:76506298-76506320 CAGTGTCTCAGCCAGCAAGGAGG + Intergenic
1160486042 18:79293556-79293578 GAGAGTCCCCACCAGCAGAAAGG + Intronic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162195789 19:8983576-8983598 CAGAGTCCCCACCAGCAACAGGG + Intergenic
1162468092 19:10854828-10854850 CACTGGCTCTACCAGCAAGAGGG + Intronic
1162543843 19:11315872-11315894 CTGAATCTCCAGCAGCCAGATGG - Intronic
1162608030 19:11726646-11726668 CAGAGTCCCCACCAGCAAGGAGG + Intronic
1162678903 19:12323552-12323574 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162682188 19:12353954-12353976 CAGAGTCTCCACCAGCAAGGAGG + Intronic
1162685991 19:12384816-12384838 TAGAGTCCCCACCAGCAGGAAGG + Intronic
1162686883 19:12394258-12394280 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1162691230 19:12434040-12434062 CAGAGTCCCCATCAGCAAGAAGG + Intronic
1162876207 19:13622807-13622829 CAGAGGCTGAACCAACAAGAGGG - Intronic
1163316607 19:16544728-16544750 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1163375714 19:16929034-16929056 ATGGATCTCCACCAGCAAGATGG - Exonic
1163745765 19:19045997-19046019 CAGATACCTCACCAGCAAGATGG - Intronic
1164549931 19:29201437-29201459 GAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1164876778 19:31696421-31696443 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1164934596 19:32201135-32201157 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1165524638 19:36343737-36343759 CAGGGTTGTCACCAGCAAGAAGG - Intronic
1165526420 19:36359015-36359037 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1165912130 19:39236102-39236124 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1166653079 19:44589975-44589997 GAGAGTCCACACCAGCAAGAAGG + Intergenic
1166897029 19:46029821-46029843 TAGAGTCCCCACTAGCCAGAAGG + Intergenic
1167017349 19:46849866-46849888 CGGAGTCTCCTCCAGGAACAGGG - Intronic
1168091348 19:54087044-54087066 GAGAGTCCCCAACAGCAAGAAGG + Intergenic
925187433 2:1858858-1858880 CAGAGACTCCACCCGGGAGAAGG - Intronic
925342621 2:3147730-3147752 CGGAGTCTTCACCAGCGAGCCGG - Intergenic
925394981 2:3527019-3527041 CCGAGTCACCACCAGCAGGCCGG + Intergenic
925605668 2:5657459-5657481 CAGCCTCTCCATCAGCACGAAGG + Intergenic
926000192 2:9324498-9324520 CAGAGCGCCCACCAGCAAGAAGG - Intronic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926124136 2:10261356-10261378 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926186550 2:10695343-10695365 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
926233182 2:11020201-11020223 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
926442292 2:12902580-12902602 TAGAGTCCCCGTCAGCAAGAAGG - Intergenic
927031562 2:19125268-19125290 CGGAGTCTCTACCAGTGAGAAGG - Intergenic
927066638 2:19478295-19478317 GAGGGTCCCCACCAGCAAGGAGG - Intergenic
927264515 2:21129910-21129932 CAGAGTCCCCACTAGCAAGGTGG - Intronic
927446096 2:23162750-23162772 CCGCATCCCCACCAGCAAGAAGG + Intergenic
927638288 2:24831707-24831729 CAGAATCTCCCCCACCATGAAGG + Exonic
927747031 2:25632668-25632690 GAGAGTCCCCAGCAGCAAGATGG + Intronic
928054083 2:28033437-28033459 CAGAGTCCCCAATATCAAGAAGG - Intronic
928790143 2:34940337-34940359 GAGAGTCCCAACTAGCAAGAAGG - Intergenic
928923575 2:36553066-36553088 CTGAGTTTCCAATAGCAAGAAGG + Exonic
929033289 2:37668710-37668732 CAGTCTCTACACCAGCAAAATGG + Intronic
930171330 2:48254759-48254781 GAGAGTTCCCATCAGCAAGAAGG - Intergenic
930256725 2:49101835-49101857 CAGAGTCCCCACCAGCAAGAAGG - Intronic
930339790 2:50097974-50097996 CAGAGTCTCTACCAGCCAAGAGG - Intronic
930381226 2:50632543-50632565 CAGAGTTTGCACCAGTAAGTTGG - Intronic
931141737 2:59466906-59466928 AAGACCCTCCACCAGCAAAAAGG - Intergenic
931832275 2:66065169-66065191 GAGAGTCCCCACCAGCATGAAGG - Intergenic
932637731 2:73407116-73407138 CAGAGTCCCCATCAGCAAGAAGG - Intronic
933063080 2:77762204-77762226 TTGAGTCTCCACTAGCAAAAAGG + Intergenic
933128479 2:78642334-78642356 CGGAGCCCCCACGAGCAAGAAGG + Intergenic
933420083 2:82033989-82034011 TAGGGTCTCCACCACCAAGCTGG - Intergenic
934673055 2:96228887-96228909 TAGAGTCCCCATCAACAAGAAGG - Intergenic
934692958 2:96375928-96375950 AAAGGTCCCCACCAGCAAGAAGG + Intergenic
935026959 2:99286144-99286166 AAGAGTCCCCACCAGCAAGAAGG + Intronic
935208063 2:100913878-100913900 CAGGGTCTCTCCCAGCAGGATGG + Intronic
935350074 2:102144991-102145013 CTGAGTGTCCACCTGCAAGCTGG + Intronic
935492762 2:103740894-103740916 CAGAGACTCCACCAGGAATAAGG + Intergenic
935504994 2:103889447-103889469 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
935545392 2:104395269-104395291 CAGACCCTCAACCAGCAGGATGG + Intergenic
935634418 2:105238710-105238732 CTGAGACTCCAACAGAAAGATGG - Intergenic
936078361 2:109416029-109416051 CAGAGTCCCCACCAGCAAGAAGG + Intronic
936770668 2:115909201-115909223 TAGTGCCTCCACTAGCAAGACGG + Intergenic
936826052 2:116582342-116582364 GAGAGTCCTCACCAGCAACATGG + Intergenic
937709002 2:124957177-124957199 CTGAGTATCCACAAGCAAAAAGG + Intergenic
937794388 2:125999618-125999640 CAAAGCCACCACCAGCAAGATGG - Intergenic
937881809 2:126873045-126873067 GAGAGTCCTCATCAGCAAGAAGG + Intergenic
937921742 2:127136299-127136321 GAGAGTCCCCAGCAGCATGAAGG + Intergenic
938078271 2:128353696-128353718 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
938564386 2:132505146-132505168 CAGAGTCCCTACTAACAAGAAGG - Intronic
938769191 2:134485507-134485529 CACAGGCCCAACCAGCAAGAAGG + Intronic
938816369 2:134908678-134908700 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
938918424 2:135968459-135968481 CAGAGTCCCCACCAGCAAGAAGG - Intronic
939046541 2:137256959-137256981 TAGACTCCCCACGAGCAAGAAGG - Intronic
939123255 2:138143609-138143631 GAGAGACCCCACCAGAAAGAAGG + Intergenic
939231051 2:139426752-139426774 AAGAGTCCTCACCAGCAAGAAGG - Intergenic
939400548 2:141686923-141686945 GAAAGTTTCCACCAGCAAGAAGG + Intronic
939565774 2:143784966-143784988 GAGAGTCCTCACCAGCAAGCAGG + Intergenic
939844200 2:147223344-147223366 CACAGTCACCACCAGCAAGAAGG + Intergenic
940121562 2:150273648-150273670 GAGATTCCCCACCAGCAAGAGGG - Intergenic
940433634 2:153624373-153624395 AATAGCCTCCACCAGAAAGAGGG - Intergenic
940504736 2:154538868-154538890 CATAGTCCACAACAGCAAGAAGG + Intergenic
940762509 2:157752601-157752623 CAGAGACCCCACAAGCTAGAAGG + Intronic
940793735 2:158055162-158055184 GAGAGCCCCCACCAGCAATAAGG - Intronic
940890040 2:159026608-159026630 GAGAGTCCCTACCAGCAAGAAGG - Intronic
941635006 2:167927013-167927035 GAGGGTCCCCATCAGCAAGAAGG - Intergenic
942209526 2:173656677-173656699 CAGTGTCTCCACCACTCAGAAGG - Intergenic
942659968 2:178254021-178254043 GAGAGTCCCCACCAGCAAGAAGG + Intronic
943051032 2:182913532-182913554 CAGAGACCCCACTAGCAAGAAGG + Intronic
943101136 2:183487889-183487911 CAGAGTCTTTACCAGTAAAATGG + Intergenic
943212591 2:184987408-184987430 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
943495254 2:188611824-188611846 AAGTGTCTTCACCAGCAAGTAGG - Intergenic
943633353 2:190279078-190279100 GAGAGTCCCCACCAGCAAGAAGG - Intronic
943635685 2:190304337-190304359 CAGAGTCCCCACCAGTAAGAAGG - Intronic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
944389175 2:199199730-199199752 GAAAGTCCCCACCAGCAAGAAGG + Intergenic
944422385 2:199545175-199545197 CAGAGTCCTGACCAGCAAGAAGG - Intergenic
944428410 2:199607636-199607658 CAGAGCCCCCGCTAGCAAGAAGG + Intergenic
944428874 2:199611997-199612019 GAGAATCCCCAACAGCAAGAGGG + Intergenic
944428985 2:199613138-199613160 TAGAGTCCTCACCAGCAAGAAGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
944660214 2:201915594-201915616 CAGAGTCTTTACCAGCGAGAAGG - Intergenic
944874676 2:203950245-203950267 GAGTGTCCCCACCAGAAAGAAGG - Intronic
944918708 2:204388283-204388305 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
944995581 2:205289867-205289889 GAGAGTCCCCACCAGCAAGAAGG + Intronic
945147658 2:206755318-206755340 CAGTGTCTCCATCTGCACGAAGG - Exonic
945151404 2:206795820-206795842 CACAATCCCCACCAGCAAAATGG - Intergenic
945158173 2:206860926-206860948 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
945159210 2:206871887-206871909 GAGAGTCTCCATGAGCAAGAAGG + Intergenic
945184214 2:207123299-207123321 CAAAGTCACCAACAGCAGGAGGG - Intronic
945211538 2:207388446-207388468 CAGAGCCTCCCCCAAAAAGACGG + Intergenic
946121717 2:217521706-217521728 TAGAGTCCCCACCATCAAGAAGG - Intronic
946136185 2:217649106-217649128 GAGAGTCCCTACCAGCAGGAAGG + Intronic
946791450 2:223304583-223304605 GAGAGTCTCCACCAGTAAGCAGG - Intergenic
946908362 2:224437357-224437379 GAGAAACCCCACCAGCAAGAAGG + Intergenic
947688738 2:232114932-232114954 GAGAGTCCCCACTGGCAAGAAGG - Intronic
947948884 2:234130493-234130515 CAGTTTCTCTACCAGCAAAATGG + Intergenic
948036288 2:234860928-234860950 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
948096476 2:235338123-235338145 AAGAGTCTACTCCTGCAAGAGGG + Intergenic
948320978 2:237069161-237069183 GAGAGTCCCCAACAGTAAGAAGG + Intergenic
948575140 2:238945063-238945085 AAGAGTTCCCACTAGCAAGAAGG - Intergenic
948995885 2:241578240-241578262 CAGAGTCTTGACCAGCAAGAAGG + Intergenic
949055192 2:241924168-241924190 CAGAGTCACCACCAGCACAAAGG - Intergenic
1169288641 20:4330414-4330436 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1169777150 20:9267994-9268016 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1170051546 20:12151090-12151112 GAGAGTCCCCGCCATCAAGAAGG - Intergenic
1170060945 20:12258558-12258580 GAGAATCCTCACCAGCAAGAAGG - Intergenic
1170172588 20:13431908-13431930 GATAGTCCCCGCCAGCAAGAAGG + Intronic
1170715496 20:18827718-18827740 GAGAGTCCCCACTGGCAAGAAGG + Intronic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171471714 20:25377476-25377498 CGGAGTCCCCACCAGCAAGAAGG - Intronic
1172031121 20:31982844-31982866 CAGAGGCCCCATCAGTAAGAAGG - Intronic
1172151985 20:32797108-32797130 TAGGGCCTCCACCAGCAAGCCGG + Intronic
1173912655 20:46681757-46681779 TAGAGTCCCCACCTTCAAGAAGG - Intronic
1174012494 20:47461761-47461783 AAGAGTCCCCAACAGCAAGAAGG - Intergenic
1174119337 20:48250540-48250562 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1174753542 20:53136073-53136095 GAGTGTCCCCACCAGCAAGAAGG - Intronic
1174919542 20:54686918-54686940 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1175296938 20:57915025-57915047 CAGAGCCCCCACCAGCAAAAAGG - Intergenic
1175299926 20:57935500-57935522 AAGTGTCCCCACCAGCAACAAGG - Intergenic
1175850783 20:62091251-62091273 CAGGTTCCCCACCAGCAAGAGGG - Intergenic
1177008489 21:15702903-15702925 GAGAGTCCCCACCAGAAAGAAGG + Intergenic
1177264843 21:18769180-18769202 CAGAGTCACCATTCGCAAGAAGG + Intergenic
1177366653 21:20148354-20148376 TAGTCTCACCACCAGCAAGAAGG + Intergenic
1177376347 21:20275137-20275159 GAGAGTCCTCATCAGCAAGAAGG - Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1177699838 21:24623902-24623924 AAGACTCTCCACCAGCCAAATGG + Intergenic
1178534307 21:33399696-33399718 GAGAATCTCCACCAGCAAGAAGG + Intergenic
1178760109 21:35394028-35394050 TAGAGTCCCCACCAGCAAGAAGG + Intronic
1178805343 21:35834585-35834607 CAGAGTGTCTTCCAGCAAGAGGG - Intronic
1178834957 21:36089071-36089093 GAGAGTCTCCACCAGCAAGTAGG + Intergenic
1178838990 21:36123469-36123491 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1178846444 21:36177768-36177790 GAGAGTCTCCACCAGCAAGAAGG + Intronic
1179097723 21:38330541-38330563 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1179194710 21:39154173-39154195 CAGAGGCCCCACCAGCAAGAAGG + Intergenic
1179582940 21:42355751-42355773 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1179651927 21:42816742-42816764 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1179922025 21:44512582-44512604 CAGGGTCTCCACCAGCCTCAGGG - Intronic
1179950656 21:44707258-44707280 CAAGGTCTCCACCAGGAAGATGG + Intronic
1180097797 21:45567872-45567894 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
1180200117 21:46219187-46219209 CTGAGTCTTCCACAGCAAGAGGG + Intronic
1180213286 21:46308924-46308946 CAGAGTCCCCAACAGCAAGAAGG + Intronic
1180724842 22:17939183-17939205 CAGAGTCCCCACCAGCAAAAAGG + Intronic
1180756779 22:18167879-18167901 CAGTCTCTCCACCTGCAAGAGGG - Exonic
1180756824 22:18168183-18168205 GAGAGTTCCCACCAGCAAGCAGG - Intronic
1181074943 22:20369260-20369282 GAGAGTCCCCACCAGCAAGCAGG + Intronic
1181074985 22:20369564-20369586 CAGTCTCTCCACCTGCAAGAGGG + Exonic
1182538231 22:31022241-31022263 CAGAGTCCCCAACAGCAAGAAGG - Intergenic
1182817648 22:33180072-33180094 CAGTCTCTCCACTACCAAGATGG - Intronic
1182989663 22:34755007-34755029 AAGAGTCCCCACCAGCAAGGAGG - Intergenic
1183325103 22:37187169-37187191 AAGAGTCACCTCCAGGAAGAGGG - Intronic
1183327095 22:37200143-37200165 CAGTTTCTCCACCTGTAAGATGG + Intergenic
1183603271 22:38852395-38852417 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
1183648908 22:39142513-39142535 CAGGGTCTGCCCCAGCAGGAGGG - Intronic
1184011349 22:41751061-41751083 CAGAGGCTCAACCTGCAAGAGGG + Intronic
1184394108 22:44222527-44222549 GAGAGCCTCCACCAGCAAGAAGG - Intergenic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
949167845 3:962321-962343 GACAGTCCCCACCAGTAAGAAGG - Intergenic
949265452 3:2151817-2151839 GAGAGTCCCCACCAGCAAGAAGG + Intronic
949441638 3:4087383-4087405 CAGACACTCCACCTGCAAGATGG - Intronic
949486074 3:4539833-4539855 GAGAGTCCTTACCAGCAAGAGGG + Intronic
949667376 3:6355830-6355852 AAAGGTCCCCACCAGCAAGAAGG - Intergenic
949707402 3:6834809-6834831 GAGAGTCTACACCAGTAAGAAGG - Intronic
950211658 3:11127698-11127720 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
950555573 3:13693836-13693858 GAGAGCCCCCAGCAGCAAGAAGG - Intergenic
950685002 3:14610514-14610536 AAGAGTCCCTACCAGCAAGAAGG + Intergenic
951180962 3:19658337-19658359 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
951857143 3:27210236-27210258 GAAAGTCTGCACCAGCAAGAGGG - Intronic
952177981 3:30887516-30887538 AAGAATCCCCACAAGCAAGAAGG + Intronic
952225472 3:31371271-31371293 GTAAGTCCCCACCAGCAAGAAGG - Intergenic
952327846 3:32336963-32336985 CAGAGTCCCCACCAGCAAAAAGG - Intronic
952413068 3:33066452-33066474 CAGAGTCCCCACCAGCAAGAAGG + Intronic
952676516 3:36037586-36037608 GAGGGTCTCCACCAGCAAAAAGG + Intergenic
952702917 3:36344665-36344687 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
952920587 3:38281461-38281483 CAGAGTTCCCAACAGCAAGAAGG - Intergenic
952926753 3:38326053-38326075 AACAGCCCCCACCAGCAAGAAGG + Intergenic
953034320 3:39198773-39198795 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
953281824 3:41565605-41565627 AAGAGTCTCCAACAGCATGATGG + Intronic
953744498 3:45563664-45563686 CAGAGTTCCCACCAGCAAGAAGG + Intronic
953833673 3:46324950-46324972 GAGTATCCCCACCAGCAAGAAGG - Intergenic
954674748 3:52309561-52309583 CAGTGTCCCCACCTGCAAAAAGG + Intergenic
956741993 3:72282369-72282391 CAGAGTCCCCATCAGCAAGAAGG + Intergenic
956916700 3:73879476-73879498 GAGTCTCTCTACCAGCAAGAAGG + Intergenic
956929337 3:74024953-74024975 CAAAGTCCCCACCAGGAAGAAGG + Intergenic
956984587 3:74684035-74684057 GAGAGACCCCACCAGCAAGAAGG - Intergenic
957011468 3:75010419-75010441 AAGAGTGTCCACCAGCAAGAGGG - Intergenic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
958445301 3:94207656-94207678 CAAAGTCACCAACAGCAAGAAGG + Intergenic
958488688 3:94745375-94745397 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
958760722 3:98304872-98304894 TTTAATCTCCACCAGCAAGATGG - Intergenic
959096449 3:101961625-101961647 GAAAGTCTTCACCAACAAGAAGG + Intergenic
959133874 3:102392414-102392436 GAGGGTTCCCACCAGCAAGAAGG - Intronic
959263669 3:104112370-104112392 CAGAGTCCTCACTGGCAAGAAGG - Intergenic
959578336 3:107959326-107959348 GAGAGTCCCAGCCAGCAAGAAGG - Intergenic
959683357 3:109120681-109120703 GAGAGTTTCCACCAGTAAGAAGG + Intergenic
959893195 3:111579592-111579614 GAGAGTCCCCATCCGCAAGAAGG - Intronic
960237265 3:115298214-115298236 CAGAGTTCCTCCCAGCAAGAAGG - Intergenic
960259352 3:115547879-115547901 CAGAGTCCCCACCATGAAGAGGG + Intergenic
960283268 3:115799524-115799546 CAAAGTCTCCACCACCTTGAAGG - Intergenic
960766290 3:121134164-121134186 CAGAGTCCCTACCAGCAAGAAGG - Intronic
960880962 3:122344453-122344475 GAGAGTCGCCACCTGCAAGAAGG - Intergenic
961063993 3:123858509-123858531 AAGAGTCCCCACCAGCAGGAAGG - Intronic
961068366 3:123896282-123896304 TAGAGACCTCACCAGCAAGAAGG + Intergenic
961314043 3:126022436-126022458 CAGAGTCCCCGCCAGCAAGAAGG - Intronic
961743981 3:129051783-129051805 CAAAGTCTCCTCCTTCAAGATGG + Intergenic
962147270 3:132853879-132853901 CAGAAACTCCACAAGCTAGAAGG - Intergenic
962390504 3:134967618-134967640 CAGAGTCCCCACCAGCAAGAAGG + Intronic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
963074161 3:141330867-141330889 GAGAGTCCCCACCAGCAAGAAGG + Intronic
963077934 3:141365367-141365389 GAGAGTCCGCACCAGCAAGAAGG - Intronic
963222986 3:142831375-142831397 GAGAGTCCCCACCAGCAAGAAGG + Intronic
963353992 3:144187339-144187361 CAGAGTCCTTATCAGCAAGAAGG + Intergenic
963542850 3:146616491-146616513 AAGAACCTCCACCAGCAAAAAGG + Intergenic
964028890 3:152113318-152113340 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
964145997 3:153464136-153464158 TAGAGTCCCCACCAGCAAGAAGG + Intergenic
964180932 3:153884769-153884791 GAGAGTCCCCACCATCAAAAAGG + Intergenic
964202813 3:154137346-154137368 GAGTGTCCCCACCGGCAAGAAGG + Intronic
964530298 3:157660523-157660545 CAGTTTCTCCACCAGGAAGGTGG + Intronic
964661740 3:159127257-159127279 CAAAGTTTCCACCAGGCAGAGGG + Intronic
964739284 3:159948675-159948697 CAGAATCCCCACCAGCAAGAAGG + Intergenic
964879134 3:161404273-161404295 GAGAATCCCCATCAGCAAGAAGG + Intergenic
965332865 3:167399050-167399072 CGGAGTCCCCACCACCAAGAAGG + Intergenic
966043280 3:175518586-175518608 GAGAGTCCCCATCAGCAGGAAGG - Intronic
966199568 3:177347928-177347950 CCAAGACTCCACCATCAAGAAGG - Intergenic
966214597 3:177489619-177489641 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
966223277 3:177571337-177571359 CAGAGCCACCACCAGCAAGAAGG - Intergenic
966343547 3:178952188-178952210 CAGAGATTCTACCAGCAAAAAGG + Intergenic
966400729 3:179544504-179544526 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
966503528 3:180673426-180673448 AAGACTCTCCACCAGCAAAATGG + Intronic
966894992 3:184437888-184437910 GGGTGTCCCCACCAGCAAGAAGG + Intronic
966897573 3:184457283-184457305 AAGAGTCCCCACCAACAAGAAGG - Intronic
966900705 3:184482026-184482048 GAGAGTCACCACCAGCAAGAAGG - Intronic
967115394 3:186332979-186333001 TAGAATCACCACCAGTAAGAAGG + Intronic
967129045 3:186453724-186453746 GACAGTCACCACCAGCAAGAAGG + Intergenic
967215471 3:187206293-187206315 AATAGTCCCCACCAGCAAGAAGG - Intergenic
967403472 3:189089580-189089602 CAGAGTCCCCACCAGCAAGGAGG - Intronic
967595609 3:191324217-191324239 GAGATTCTCCACCAGCAAGAAGG + Intronic
967689953 3:192462479-192462501 GAGAGTCCCTACCAGCAAGAAGG + Intronic
967762875 3:193244697-193244719 CAGAGTCTCCACCAACAAGAAGG - Intronic
968027186 3:195452265-195452287 CGGAGTCCCCACCAGCAAGAAGG - Intergenic
968539548 4:1157332-1157354 AAGACCCTCCACCAGCAAAAAGG - Intergenic
968674160 4:1868482-1868504 GAGAGTCCACACCAGCAAGAAGG - Intergenic
968944750 4:3657799-3657821 CACATCCTCCACCAGCGAGACGG - Intergenic
969046787 4:4342161-4342183 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
969096929 4:4740224-4740246 GAGAGTCCCTGCCAGCAAGAAGG + Intergenic
969229307 4:5818710-5818732 CAGAGTCCCCACCAGCAAGAAGG + Intronic
969834021 4:9824237-9824259 AAGAGGCCCCACCAGTAAGAAGG + Intronic
969921514 4:10544803-10544825 CAGAGTCACCACCCGCAAGAAGG - Intronic
970395246 4:15658609-15658631 CAGAGTCGCCACCAGAAAAAAGG + Intronic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971459021 4:26874012-26874034 CTGAGTCTCCACCAGCCACTTGG + Intronic
971493375 4:27237871-27237893 GAGTGTCCTCACCAGCAAGAAGG - Intergenic
972239953 4:37179573-37179595 GAGAGTCCCTACCAGCAAGAAGG + Intergenic
972362125 4:38336372-38336394 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
972449163 4:39179946-39179968 GAGAGTCCGCACCAGCAAGAAGG + Intergenic
972642581 4:40939065-40939087 GAGAGTCCCCACCAGGAAGAAGG + Intronic
972866001 4:43233459-43233481 CAGATTCCTCACCAGCAAGAAGG - Intergenic
972966265 4:44514112-44514134 CAGAGTCTCCTCCAGCTTGCAGG + Intergenic
973313936 4:48739970-48739992 GAGAGTCCTCACTAGCAAGAAGG + Intronic
973576965 4:52299268-52299290 CAGAGCCTCCAACAGCATGCTGG - Intergenic
973841520 4:54865800-54865822 CAGAGTTCCCACAAGCAAGAAGG + Intergenic
974354646 4:60796693-60796715 CATGGTCCCCACTAGCAAGAAGG - Intergenic
974422407 4:61694575-61694597 AAGATCCTCCACCAGCAAAAAGG - Intronic
974472519 4:62337109-62337131 GAGTGTCCTCACCAGCAAGAAGG + Intergenic
974667477 4:64983396-64983418 AACACTCTCCACCAGCAAAAAGG + Intergenic
975325247 4:73051781-73051803 CAGAGTCCCCACTAGCAAGAAGG - Intergenic
975334413 4:73158862-73158884 CAGAGTCCCTGCCAGCAAGAAGG + Intronic
975434310 4:74334040-74334062 CTGTGGCTCCACCAGCAGGAGGG + Intergenic
976249213 4:83033545-83033567 GCAAGTCCCCACCAGCAAGAAGG - Intergenic
976262646 4:83160282-83160304 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
976607625 4:86997295-86997317 TAGAGTCCCCACCAGCAAGAAGG + Intronic
976748874 4:88433621-88433643 CAGAGTTCTCATCAGCAAGAAGG + Intronic
977722133 4:100251523-100251545 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
978291177 4:107142604-107142626 GAGAGTTCCCACAAGCAAGAAGG + Intronic
978770604 4:112452553-112452575 CAGAATCTCCCCCAGACAGAAGG + Intergenic
979018647 4:115467036-115467058 CAGAGTCCTCATCAGCAAGAAGG + Intergenic
979050245 4:115921159-115921181 TAAAGTCATCACCAGCAAGATGG - Intergenic
979527644 4:121734262-121734284 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
979601728 4:122592800-122592822 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
979621568 4:122804384-122804406 GAGAGTCCCCATCGGCAAGAAGG - Intergenic
980005411 4:127536615-127536637 CAGAGTCCCTACCAGCAAGAAGG + Intergenic
980041839 4:127948816-127948838 GAGAGTCCCCACCAGCAAGAAGG + Intronic
980952607 4:139396400-139396422 AAGACCCTCCACCAGCAAAAAGG - Intronic
980996332 4:139783241-139783263 CACAGTCTTCACCAGGCAGATGG + Intronic
981179688 4:141725912-141725934 GAGAGCCCCCACCAGCAGGAAGG - Intronic
981275079 4:142889940-142889962 GAGAGTCTCCAGCAGCAAGAAGG - Intergenic
981361019 4:143845727-143845749 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981371757 4:143966729-143966751 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
981380847 4:144069927-144069949 CAGAATCCCCACCAGCAACAAGG - Intergenic
981699831 4:147596258-147596280 GAGAGTCTTCATCAGCAAGAAGG + Intergenic
981849344 4:149210390-149210412 CAGAGTCCCCATCAGCAAGAAGG - Intergenic
982118909 4:152120351-152120373 GAGAGTCCCCACCGGCAAGAAGG + Intergenic
982312059 4:153996787-153996809 CAGAGTCTACACAAATAAGAAGG - Intergenic
982429841 4:155310196-155310218 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
982508418 4:156250007-156250029 CACAGTCCCAATCAGCAAGACGG + Intergenic
982515047 4:156335368-156335390 AAGAGTCTACACCAGCAAGAAGG + Intergenic
982520525 4:156410903-156410925 AAGACCCTCCACCAGCAAAAAGG - Intergenic
982639824 4:157944488-157944510 CAGAGTCACCACCAGTAAAAAGG - Intergenic
982690592 4:158543537-158543559 CAGTGTCTCCACAAACAAGATGG + Intronic
983163493 4:164447058-164447080 AAGGGTCTCCACCAGCAAGAAGG - Intergenic
983163710 4:164448955-164448977 CAGGGTTTCCACCAGCAAGAAGG - Intergenic
983768815 4:171521834-171521856 TAGAGACCCCACCAACAAGAAGG - Intergenic
983895119 4:173072980-173073002 CAGAGTCTCCACCAGCAAGAAGG + Intergenic
984009951 4:174358514-174358536 CACAGTCCTCACCAGGAAGAAGG + Intergenic
984147370 4:176079785-176079807 CAGAGTCCCAACCAGCAGGAAGG - Intronic
984435895 4:179709778-179709800 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
984510833 4:180676758-180676780 TAGAGTCTCCACCATTAAAAAGG - Intergenic
984580255 4:181502639-181502661 CCCAGTCTCCACCACCAAGCAGG - Intergenic
984882710 4:184424611-184424633 GAGGGTCCCCACCAGCAAGAAGG + Intronic
985375587 4:189334047-189334069 GAGTGTTCCCACCAGCAAGAAGG - Intergenic
985473057 5:58093-58115 GGGAGTCTCCACCAAGAAGAAGG + Intergenic
985556536 5:561377-561399 CAGTTTCCCCATCAGCAAGATGG + Intergenic
986183021 5:5411212-5411234 GTGTGTCTCTACCAGCAAGAAGG + Intergenic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
986908570 5:12525424-12525446 GATGGTCTCCACCAGCAAGAAGG - Intergenic
986984807 5:13488437-13488459 GAGAGTCTCCATCAGCAAGAAGG + Intergenic
987159431 5:15125892-15125914 GAGAGTCCCCACCAGTAAGAAGG + Intergenic
987218279 5:15762275-15762297 CAGAGTGTCTGCTAGCAAGACGG + Intronic
987798985 5:22668519-22668541 GAGAGTCTCCATCAGCAGGAAGG - Intronic
988186397 5:27869145-27869167 GAGTGTTTCCACCAGCAAGAAGG + Intergenic
988443878 5:31263177-31263199 GAGAGTCCCCACCAGTAAGAAGG - Intronic
988788265 5:34584091-34584113 GAGAGTCCCCACCAGAAAGAAGG - Intergenic
989005341 5:36804658-36804680 CCGAGTCCCTACCAGCAAGAAGG + Intergenic
989722345 5:44544105-44544127 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
990339966 5:54812796-54812818 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
990463611 5:56052013-56052035 GAGAGTCCCCATCAGCAAGAAGG - Intergenic
990828640 5:59931465-59931487 GAGGGTCCCCACCAGCAAGAAGG - Intronic
990969053 5:61483146-61483168 CAGAGTCCCCACCAGCAAGAAGG - Intronic
991168716 5:63594674-63594696 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
992035843 5:72775169-72775191 AAGAGGCCCCACCAGCAAGAAGG + Intergenic
992056393 5:72995643-72995665 CAGACTCCCCACAAGCAAGAAGG - Intronic
992158485 5:73977993-73978015 GAGAGCCCCCGCCAGCAAGAAGG + Intergenic
992214180 5:74509046-74509068 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
992833085 5:80614584-80614606 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
993123450 5:83803235-83803257 CAAAGTTCCCACCAGCAAGAAGG - Intergenic
993169236 5:84395957-84395979 GAAATTCCCCACCAGCAAGAAGG - Intergenic
993797876 5:92291734-92291756 CAAAGTCCAAACCAGCAAGAAGG - Intergenic
994379353 5:99053009-99053031 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
994433156 5:99694964-99694986 CACAGTTTCCACCTGCAAAAGGG - Intergenic
994640082 5:102396809-102396831 CAGAGTACCCACCAGCCAGAAGG - Intronic
995345639 5:111113732-111113754 CAGAGTCTCCACCAGCAAGAAGG - Intronic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
995572280 5:113492682-113492704 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
996102578 5:119459639-119459661 CAGAGTCCCCACCAGAAAGGAGG - Intronic
996597865 5:125226125-125226147 CAGAGTACCCACCCCCAAGATGG - Intergenic
996643223 5:125783426-125783448 AAGAGCCCCCACCAGCAAAAAGG + Intergenic
996734596 5:126747186-126747208 GAGAGTCTCCACCAGCAAGAAGG - Intergenic
996783069 5:127209516-127209538 CTGAGTCCCTACCAGCAAGAAGG - Intergenic
997067430 5:130578143-130578165 GAGAATCTCTACCAGCAAGAAGG + Intergenic
997189124 5:131914149-131914171 GAGAGTCCCCATCAGCAAGAAGG + Intronic
997595815 5:135106840-135106862 CAGAGGCTCCAGCAGTGAGAGGG + Intronic
997824349 5:137092905-137092927 CAGAGCCCCCACCGGCAAAAAGG - Intronic
997824542 5:137094620-137094642 AAGACCCTCCACCAGCAAAAAGG - Intronic
997883085 5:137607929-137607951 CACAGTCTACACCAGGAACACGG - Intergenic
997903382 5:137789724-137789746 CACGGTCCCCACCAGCAATAAGG - Intergenic
998175285 5:139898091-139898113 CAGAATCTCCACCAGGGCGAAGG - Intronic
998781585 5:145662767-145662789 GAGAGTCACCACCAGCAAAAAGG + Intronic
999138058 5:149336572-149336594 GAGAGACCCCATCAGCAAGAAGG - Intronic
999260977 5:150238890-150238912 CAGATTCTCCAGCCTCAAGACGG + Intronic
1000153512 5:158527463-158527485 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1000267572 5:159652422-159652444 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1000681790 5:164194331-164194353 CAGAGGCTCCACCATCTGGAAGG + Intergenic
1000845453 5:166274532-166274554 CAGAATCTGCACCAGCAAGAAGG - Intergenic
1001163020 5:169338166-169338188 CAGAGTCTGCACTTGCAAGGAGG - Intergenic
1001440758 5:171741030-171741052 GAGAGTCCCCACCTGCAAGAAGG - Intergenic
1001450737 5:171822424-171822446 CAGAGACTGCATCTGCAAGATGG + Intergenic
1001654644 5:173340239-173340261 GAGAGTCCCAAGCAGCAAGAAGG + Intergenic
1001762927 5:174222702-174222724 AAGATACCCCACCAGCAAGAAGG - Intronic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002131552 5:177085297-177085319 CAGGGTCTACACTAGCTAGAGGG + Intergenic
1002193822 5:177491859-177491881 CAGCGTCTCCCTCAACAAGACGG - Exonic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002792875 6:448503-448525 CAGAATCCCCACCAGCAAGAAGG + Intergenic
1002857529 6:1051452-1051474 GAGAGGCCCCACCAGCAAGAAGG - Intergenic
1003232717 6:4269225-4269247 CAGAGTCTCCACCAGCCAGAAGG + Intergenic
1003304319 6:4912727-4912749 CAGAGTCCTCACCAGCAAAGAGG - Intronic
1003326658 6:5097137-5097159 GAGAGTCTCCACCAGCAAGAAGG - Intergenic
1003364999 6:5464989-5465011 CGCACTCTCCACCAGCTAGAGGG - Intronic
1003459423 6:6316818-6316840 CAGTTTCTCCATCAGCAAAATGG - Intronic
1003513258 6:6799167-6799189 CAGTGTCCCTACCAGCAGGAAGG - Intergenic
1003613793 6:7636897-7636919 CAGAGTCCCCTCCAGCAAGAAGG - Intergenic
1003616417 6:7659020-7659042 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1003649062 6:7941559-7941581 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1003989719 6:11473587-11473609 CAGGGTCACCACCACCCAGAGGG + Intergenic
1004247757 6:13996446-13996468 GAGAGTGCCCACCAGCAAGCAGG - Intergenic
1005006467 6:21292259-21292281 CAGAGTCTCCACTAACATGAAGG - Intergenic
1005107192 6:22236432-22236454 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1005694822 6:28342108-28342130 AAGAGTCTCCTTCAGCCAGAAGG + Intronic
1005986605 6:30879885-30879907 CTGAGTCTACATCAGTAAGAGGG - Intronic
1006207646 6:32362380-32362402 GAGAGTCCCCAGTAGCAAGAAGG + Intronic
1006674403 6:35751875-35751897 CAGTGTATTCAGCAGCAAGAAGG - Intergenic
1006818351 6:36869370-36869392 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1007101462 6:39250307-39250329 GAGAGTCCCCTCTAGCAAGAAGG + Intergenic
1007427404 6:41756504-41756526 CAGAGCCTCCCTCAGCAGGAAGG + Intergenic
1007526872 6:42503708-42503730 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1009723699 6:67508486-67508508 GAGAGACCCCACCAGCAAGAAGG - Intergenic
1010189376 6:73179266-73179288 GAGAGTCCCCACCAACAAGAAGG - Intronic
1010302268 6:74274813-74274835 GCAGGTCTCCACCAGCAAGAAGG - Intergenic
1010583131 6:77623892-77623914 GAGAATCCCCACCAGCAAGAAGG - Intergenic
1011115459 6:83886107-83886129 GGGAGTCCCCACTAGCAAGAAGG - Intronic
1011324629 6:86136049-86136071 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1012287530 6:97410520-97410542 AAGAATCTCCACCAGCAAAATGG - Intergenic
1012786960 6:103642638-103642660 CAGAGTCTCAAGAAGAAAGAAGG + Intergenic
1012865878 6:104617223-104617245 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1013043193 6:106457201-106457223 GAGAGTCCCTACCAGCAAGAAGG - Intergenic
1013172830 6:107652798-107652820 AAGACTCTCCACCAGCAAAAAGG + Intronic
1013175561 6:107673679-107673701 GAGAGGCCCCATCAGCAAGAAGG - Intergenic
1013250692 6:108330087-108330109 GAGAGTCTTCACCAGCAAGAAGG + Intronic
1013357228 6:109356755-109356777 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1013414891 6:109916315-109916337 AAGACCCTCCACCAGCAAAAAGG + Intergenic
1014019189 6:116568039-116568061 CAGAGTCCCCACATGCAAGAAGG + Intergenic
1014227417 6:118863771-118863793 GAGAGTCCTCATCAGCAAGAAGG + Intronic
1014462972 6:121720546-121720568 CAGAGTTTCCATCTACAAGATGG - Intergenic
1014644865 6:123960404-123960426 CAGTGTCTACACCACCAAGCAGG + Intronic
1014932754 6:127353476-127353498 CAGAGTTCCTATCAGCAAGAAGG - Intergenic
1014948829 6:127530245-127530267 GAGGGTCCCCACCAGCAAGAAGG - Intronic
1015208645 6:130670959-130670981 CAGAGTCTCTCCCAATAAGAAGG - Intergenic
1015317396 6:131831875-131831897 CAGATACTCCACCATCAAGGAGG - Intronic
1015619113 6:135111601-135111623 CAAAGTTTCCACCAGCAAGTTGG + Intergenic
1015652804 6:135481158-135481180 TAGAGTCCTCACCAGCAAAAAGG + Intronic
1015701052 6:136036734-136036756 CAGATTATACACCAGCAAAATGG + Intronic
1015810266 6:137155420-137155442 GAGAGTCCCCACCAGCAAGAAGG - Intronic
1015935055 6:138400798-138400820 GAGAGTCCCCACCAGCAGGAAGG - Intergenic
1016198224 6:141373256-141373278 TGGAGTCCCCATCAGCAAGAGGG + Intergenic
1016386029 6:143531685-143531707 GGGAGTCCCCACCAGCAAGAAGG + Intergenic
1016440314 6:144076549-144076571 GAGAGTCCCCACAAGCAAGAAGG + Intergenic
1016623970 6:146144477-146144499 CAGTGTCCCCACTAGCAACAAGG + Intronic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017363006 6:153598630-153598652 CAGAGTAACCATCAGCAAGAAGG - Intergenic
1017484224 6:154888328-154888350 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1017755144 6:157523083-157523105 TCCAGACTCCACCAGCAAGAGGG + Intronic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1017836205 6:158180576-158180598 CCAAGTCTCAACCAGGAAGAAGG - Intronic
1017931339 6:158958367-158958389 CACAGTTCCCACCAGGAAGAAGG - Intergenic
1017931650 6:158960642-158960664 AAGGGTCCCCACCAGCAAGAAGG - Intergenic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018411162 6:163550194-163550216 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1018828923 6:167427317-167427339 GAGAGACCCTACCAGCAAGAAGG - Intergenic
1019282096 7:205730-205752 CAGAGTCCCCACCATCCACAGGG - Intronic
1019871639 7:3769305-3769327 GAGAGTCCCCACCAACAAAAGGG - Intronic
1020077761 7:5269741-5269763 AGGAGTCCCCACTAGCAAGAAGG - Intergenic
1020286379 7:6684472-6684494 CAGAGTCGCCGCCAGCATGAAGG + Intergenic
1020351795 7:7227824-7227846 GAGAGTCCTCAACAGCAAGAAGG + Intronic
1020738886 7:11987883-11987905 CAGAGACTTCACCAGCAAAAAGG + Intergenic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1021110981 7:16694375-16694397 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1022193831 7:28044332-28044354 CAAAGTCTTCACCTGCAAAATGG + Intronic
1022235142 7:28453894-28453916 CAGAGCCTCTTCCAGCAAAAAGG - Intronic
1022491539 7:30824186-30824208 GAGAGCCCCCACTAGCAAGAAGG - Intronic
1023036554 7:36136199-36136221 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1023564174 7:41507166-41507188 CAGAGCCAACACCAGAAAGAGGG + Intergenic
1023642137 7:42269980-42270002 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1023715298 7:43037759-43037781 CAGAGTCGCCAACAGCAAGAAGG + Intergenic
1023729416 7:43176506-43176528 CAGAGTCCCCACCAGTAAGAAGG - Intronic
1023795357 7:43787804-43787826 CAGGGTCCCGACGAGCAAGATGG - Intronic
1023854770 7:44176045-44176067 CAGAGGTTCCATGAGCAAGAAGG - Intronic
1024116700 7:46201074-46201096 CAGAGTCCCTACCAGCAAGAAGG - Intergenic
1024240607 7:47432380-47432402 CAGAATCCCCAACAGCAAGAAGG + Intronic
1024467319 7:49725321-49725343 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1024673350 7:51616531-51616553 CAGAGTCCCCACTAGCAGGAAGG - Intergenic
1024822740 7:53352537-53352559 GAGGGGCCCCACCAGCAAGAAGG - Intergenic
1025201126 7:56962430-56962452 AGGAGTCCCCACTAGCAAGAAGG + Intergenic
1025670818 7:63614502-63614524 AGGAGTCCCCACTAGCAAGAAGG - Intergenic
1026108844 7:67442498-67442520 GAAAATCCCCACCAGCAAGAAGG + Intergenic
1026241101 7:68575860-68575882 GAGAGTCCTCACCAGCAAGAAGG - Intergenic
1026367803 7:69667069-69667091 TAGAGTCCCCACCAGTGAGAAGG - Intronic
1026500332 7:70938255-70938277 GAGAGTCCCCACTAGTAAGAAGG - Intergenic
1028178154 7:87681623-87681645 AAGACCCTCCACCAGCAAAAAGG - Intronic
1028194285 7:87887628-87887650 CAGAGTCTCCACCAACAAGAAGG - Intronic
1028445937 7:90924160-90924182 GAGAGTCCCCACTAACAAGAAGG - Intronic
1028534096 7:91872044-91872066 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1028990784 7:97046856-97046878 GAGAGTCCCCACCAGTAAGAAGG + Intergenic
1029167420 7:98602565-98602587 GAGAGTCCCCATCAGCAAGGAGG + Intergenic
1029898854 7:104018772-104018794 CATAGTCTTCAATAGCAAGAAGG + Intergenic
1030028923 7:105351242-105351264 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1030078335 7:105755886-105755908 CTGTGTCTCCACCTGCATGACGG - Intronic
1030109153 7:106011767-106011789 CAGAGCCTCCTACAGCAAGCTGG + Intronic
1030879597 7:114861212-114861234 GAGGGTCCCCGCCAGCAAGAAGG + Intergenic
1031251674 7:119390799-119390821 CAGAGTACCCATCAGCAAAAAGG - Intergenic
1031744979 7:125484331-125484353 CAGAATCCCCACCAGCAAGAAGG - Intergenic
1032010112 7:128340443-128340465 CAGAGTCCCCACCAACAAGAAGG + Intronic
1032341309 7:131075833-131075855 GAGACTCACGACCAGCAAGAAGG - Intergenic
1032968010 7:137124109-137124131 TGCAGTCTCCACCAGTAAGAAGG - Intergenic
1033082250 7:138309316-138309338 GAGAATCTCCACCAGCAGGAAGG - Intergenic
1033262399 7:139855121-139855143 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1033286673 7:140047432-140047454 TGCAGTCCCCACCAGCAAGAAGG + Intronic
1033561541 7:142536698-142536720 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1034090948 7:148363541-148363563 CAGAGGTTCCTCCAGCATGAAGG - Intronic
1034717849 7:153260194-153260216 TTGGGACTCCACCAGCAAGACGG - Intergenic
1035059167 7:156056501-156056523 CAGAGTCTCTAAAAGCAACATGG - Intergenic
1035122286 7:156578776-156578798 CAGGCTCTCCACCTGCAAGCTGG + Intergenic
1035879776 8:3233370-3233392 CAGAATCCCCACCAGCAAGAGGG + Intronic
1035909483 8:3549718-3549740 GAAAGTTCCCACCAGCAAGAAGG + Intronic
1036049858 8:5184301-5184323 GAGAGTCCCCATCAGCAAGAAGG + Intergenic
1036470844 8:9051258-9051280 CAGAGTCCCCACCAGCAACAAGG - Intronic
1036807760 8:11847133-11847155 CAGCGTCTCCAATAGCGAGAAGG - Exonic
1037244662 8:16819302-16819324 CAGGGTTTCCAGCAACAAGAGGG - Intergenic
1037287340 8:17315428-17315450 CAGAATGTCCAACAGCAAGAGGG + Intronic
1037534400 8:19811380-19811402 GGGAGTCTCCAGCAGCAAGTAGG - Intergenic
1038001966 8:23399585-23399607 CCAAGTCCCCACCAGCAAGAAGG + Intronic
1038158827 8:25017210-25017232 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1038448636 8:27623521-27623543 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1038515778 8:28186641-28186663 GAAAGTCCCCACCTGCAAGAAGG - Intronic
1038661822 8:29504138-29504160 CTGAGTCTTCAGCAGCACGATGG - Intergenic
1038691864 8:29771614-29771636 CAGAGTCCCCACCAGCAGGAAGG + Intergenic
1038821086 8:30952407-30952429 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1039073845 8:33670954-33670976 GAGAGTCCCCATCAGCAGGAAGG + Intergenic
1039204429 8:35135151-35135173 GAGAGTCCTCATCAGCAAGAAGG - Intergenic
1039252288 8:35679901-35679923 GGGAGTCCCCACCAGCAAGAAGG - Intronic
1039320983 8:36430848-36430870 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1039376859 8:37043400-37043422 GAGAGTCCTCACCAACAAGAAGG + Intergenic
1039577939 8:38639958-38639980 GAGAATCTCCACCAGCAGGAAGG + Intergenic
1039746307 8:40431129-40431151 CAGACACTTCACCAGCAGGAAGG + Intergenic
1040047802 8:42980970-42980992 GAGAGTCCCCACCAGCAGGCAGG + Intronic
1040454755 8:47585690-47585712 CAGAGTCTCCACCAGCAAGAAGG - Intronic
1040956471 8:52984631-52984653 CTGAGTCTCTACCAGCTCGATGG + Intergenic
1041029832 8:53725316-53725338 CAGAGTCCTCACCAACAAGAAGG + Intronic
1041153971 8:54964503-54964525 CAGAGTCACCACCAGCAAAAAGG + Intergenic
1041356686 8:57007904-57007926 GAGTGTCCCCACCAGCAAGAAGG + Intergenic
1041361482 8:57059152-57059174 GAGAGTCCCTACCAGCAAGAGGG - Intergenic
1041621947 8:59981167-59981189 AAGACCCTCCACCAGCAAAAAGG - Intergenic
1041768509 8:61446484-61446506 CATAGTCCCCACCAGCAAGAAGG - Intronic
1042624919 8:70747540-70747562 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1042724293 8:71856249-71856271 CAGAGTTCCCATTAGCAAGAAGG + Intronic
1042867472 8:73368455-73368477 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1043134563 8:76505264-76505286 CAGACTTCCCACCAGCAAGAAGG - Intergenic
1043169059 8:76941223-76941245 CAGAGACCCCATCAGCAAGAAGG - Intergenic
1043495479 8:80796213-80796235 GAGAGTTCCCACCAGCAATAAGG - Intronic
1043563185 8:81519093-81519115 GAGAGTACCCACCAGCAAGAAGG - Intergenic
1043571826 8:81612499-81612521 AAGAATCCCCACCAGCAAGAAGG + Intergenic
1043811729 8:84750790-84750812 TAGGGTCCCCACTAGCAAGAAGG + Intronic
1044182159 8:89209491-89209513 CTGAGACTCCATGAGCAAGAAGG + Intergenic
1044195541 8:89372721-89372743 CAGAATTCCCACCAGCAAGAAGG - Intergenic
1045348901 8:101320097-101320119 CAGAGTCCCCACCAGTAAGAAGG - Intergenic
1046236455 8:111429573-111429595 CATACTCTCCACCAGGAACATGG + Intergenic
1046250392 8:111623789-111623811 GAGAGTCCCCACAAACAAGAAGG - Intergenic
1046511689 8:115212029-115212051 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1046880597 8:119302961-119302983 CAGAGTCCCCACCAGCAAGAAGG - Intergenic
1047007520 8:120636140-120636162 GAGAGTCTGCATCAGCAAGAAGG - Intronic
1047013544 8:120698637-120698659 TGGAGTCTCTTCCAGCAAGAAGG - Intronic
1047435730 8:124834270-124834292 CAGTTTCTCCACCTGCAAAATGG - Intergenic
1047590316 8:126320163-126320185 GAGAGTCCTCACCAGCAAGAAGG + Intergenic
1047957502 8:129986667-129986689 CAGATTCCCCACCAGCAAGAAGG + Intronic
1048020448 8:130533702-130533724 AAGACTCTCCACTAGCAAAAAGG - Intergenic
1048025435 8:130582387-130582409 GCGAGTTCCCACCAGCAAGAAGG + Intergenic
1048274574 8:133056627-133056649 CAGATTCTCCAACTGCAAAACGG + Intronic
1048333063 8:133484251-133484273 CAGGGCCTGCACCAGCAAGATGG + Intronic
1048451973 8:134541408-134541430 CAGAGTCCCCACCAGCAAGAAGG + Intronic
1048602614 8:135933988-135934010 CAGAGTCCCTGCCAGCAGGAGGG + Intergenic
1048671497 8:136728261-136728283 CAGAGTGTCTGCTAGCAAGATGG - Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049269516 8:141686812-141686834 CTGAGTCTCTGCCAGCAGGAAGG + Intergenic
1049500059 8:142957784-142957806 GAGAGTCCCCACCAGCCAGAAGG - Intergenic
1049943299 9:569510-569532 TCAAGTCCCCACCAGCAAGAAGG + Intronic
1050278744 9:4028221-4028243 CAGTTTCTCCATCTGCAAGATGG + Intronic
1050341602 9:4645439-4645461 CAGAGTCCCCACCAGCAAGAAGG - Intronic
1051077489 9:13257256-13257278 CAGAGTCCCCACATGCATGATGG - Intronic
1051297060 9:15608004-15608026 CAGAGTTCCCATCAGCAAGAAGG - Intronic
1051304757 9:15697749-15697771 AAGACTCTCCACCAGCAAAAAGG - Intronic
1051742914 9:20268576-20268598 CAGAGTCTCCACCAGCAAGAAGG + Intergenic
1052222039 9:26036312-26036334 GAAAGCTTCCACCAGCAAGAAGG - Intergenic
1053017679 9:34672555-34672577 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1054765574 9:69039865-69039887 CAAAGTCCCCACCAGCAAGAAGG - Intronic
1055020629 9:71665609-71665631 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1055328383 9:75156108-75156130 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1055843902 9:80537715-80537737 CAGAGTCCCCACTAGCAAGAAGG + Intergenic
1056256625 9:84805897-84805919 AAGATTTCCCACCAGCAAGAAGG + Intronic
1056454728 9:86748799-86748821 GGGAGTCCCTACCAGCAAGAAGG + Intergenic
1056560330 9:87724172-87724194 AAGAATCCCCACAAGCAAGAAGG + Intergenic
1056566899 9:87781183-87781205 GAGATTCCCCACTAGCAAGAAGG - Intergenic
1056628561 9:88274187-88274209 CAGAGTATCCTCCAGCATAAGGG + Intergenic
1056642499 9:88383328-88383350 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1057078642 9:92155368-92155390 CTGAGCCTGCACCAGCGAGAGGG + Intergenic
1057306602 9:93916106-93916128 CAGAGAGTCCACCAGCAGGCGGG + Intergenic
1057553006 9:96065797-96065819 CAGAGTCCCTGCCAGCAAGAGGG + Intergenic
1057570841 9:96203195-96203217 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
1058048622 9:100383929-100383951 CAGAGAGTCTCCCAGCAAGAAGG + Intergenic
1058114034 9:101064781-101064803 CAGAGTCCCCATCGGAAAGAAGG - Intronic
1058395404 9:104547551-104547573 CAGTGTCCCCACTAGTAAGAAGG - Intergenic
1059459038 9:114418146-114418168 CACAGTCCCCACCGGCAGGAAGG + Intronic
1059459340 9:114420007-114420029 CACAGTCCCCACCGGCAGGAAGG + Intronic
1059744574 9:117187680-117187702 GACAGTCCCCATCAGCAAGAAGG + Intronic
1059965064 9:119605740-119605762 CAGTGTCCCCACCACCAAGCTGG - Intergenic
1060253576 9:122005520-122005542 CAGAGAGGGCACCAGCAAGAAGG - Intronic
1060270565 9:122137725-122137747 CACTGTCTCCCCCAGCAAGCTGG + Intergenic
1060315389 9:122505273-122505295 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1060391336 9:123279792-123279814 CAGAGTCCCCACTAGCAAGAAGG + Intergenic
1061614372 9:131770049-131770071 CAGAGTCTCAACAAGGAAAAGGG - Intergenic
1061796632 9:133089211-133089233 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1062370245 9:136235050-136235072 CTGGGTCTCCACCTGCAAGGAGG - Intronic
1185664383 X:1753379-1753401 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1185714729 X:2331950-2331972 AAGACTCTCCACCAGCAATAAGG + Intronic
1185841422 X:3395136-3395158 GAGAGTCCCCACCAGCAAGAAGG + Intergenic
1186196409 X:7113964-7113986 TGGAGTCCCCACCAGCAAGAAGG - Intronic
1186251310 X:7669763-7669785 CAGAGTCTCCACCAGCAAGAGGG + Intergenic
1186368177 X:8917922-8917944 GAGAGTCCCCACCAGGAAGAAGG + Intergenic
1186387825 X:9127772-9127794 CAGAGTCCTCACCAGCAAGAAGG + Intronic
1186586111 X:10874884-10874906 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1186910200 X:14155667-14155689 GAGAGTTTCCATTAGCAAGAAGG + Intergenic
1186987913 X:15036613-15036635 CAGAGTCTCTATCAGCAAGAAGG - Intergenic
1187286125 X:17905532-17905554 GACAGTCCCCACCAGCAAGAAGG + Intergenic
1187592000 X:20727011-20727033 AAGAGTCCCTACCAGCAAGAAGG - Intergenic
1188285954 X:28325815-28325837 CAGAGTCTCCACCAGCAAGAAGG - Intergenic
1188686311 X:33074723-33074745 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1188801453 X:34536179-34536201 CAGAGTCCCCACCAGCAAGAAGG + Intergenic
1189024488 X:37377898-37377920 TAGAGTCAACAACAGCAAGATGG - Intronic
1189136493 X:38555995-38556017 CAGAGTCCCCATCAGCAAGAAGG - Intronic
1189421992 X:40864317-40864339 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1190144817 X:47880905-47880927 CAGAGTCCCCACCAATGAGAAGG - Intronic
1190327989 X:49218512-49218534 CAGAATCTTCACCACCGAGATGG + Exonic
1190527749 X:51345161-51345183 AAGAGTCCTCACCAGCAAGAAGG + Intergenic
1190547038 X:51538326-51538348 CAGAGTACCCACCAGTAAGAAGG + Intergenic
1190551860 X:51591120-51591142 CAGAGTACCCACCAGTAAGAAGG - Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1191127948 X:56977871-56977893 GAGAGTTTCTACCATCAAGAAGG + Intronic
1192051163 X:67725193-67725215 AAGAGCCCCCACCACCAAGAAGG + Exonic
1192174493 X:68877383-68877405 GACAGGCTCCACCAGCAACAAGG - Intergenic
1192473203 X:71417275-71417297 CAGAGTTTCCACTAGCAAAAAGG + Intronic
1192667685 X:73105050-73105072 GAGAGTCTCCAACAACCAGAAGG - Intergenic
1192847002 X:74916601-74916623 CAGAGAATTCACCAGCAAGAAGG + Intronic
1192961832 X:76139231-76139253 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1193231120 X:79047825-79047847 CAGAGTCTCTGCCAGTGAGAAGG + Intergenic
1193261994 X:79418563-79418585 GAGAGTCTCCACCAGCAACAAGG + Intergenic
1193368195 X:80659767-80659789 CAGAGTCCCTATCAGCAAGAAGG + Intergenic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1194388673 X:93289016-93289038 GACTGTCTCCACCAGCAAAAAGG - Intergenic
1194469169 X:94271332-94271354 GAGAGTCCTCACCAGTAAGAAGG + Intergenic
1194798873 X:98246587-98246609 TAGAGTCCCTACCAGCAAGAAGG - Intergenic
1196054383 X:111339474-111339496 GAAAGTCCCTACCAGCAAGAAGG + Intronic
1196881632 X:120204252-120204274 GAGAATCCCCACCAGCTAGAGGG - Intergenic
1197358332 X:125465800-125465822 AAAAGCCTCCACCAGCAAAAAGG - Intergenic
1197718942 X:129731622-129731644 CAGTGTCTCCTCTAGCAACAGGG - Intergenic
1198181461 X:134213783-134213805 CTAAGTCCCCACCAGCAAGAAGG + Intergenic
1198319615 X:135506768-135506790 GAAAGTGCCCACCAGCAAGAAGG + Intergenic
1198460974 X:136862687-136862709 CAGCGTCCCCACCAGCAAGGAGG - Intronic
1198967056 X:142238165-142238187 AAGAGTCCCCACCAGCAAGAAGG - Intergenic
1199429943 X:147747500-147747522 GAGAGTCCCCACCAGCAAGAAGG - Intergenic
1199735966 X:150687014-150687036 CAGCGTTCCCACCAGGAAGAAGG - Intergenic
1199751476 X:150823681-150823703 GAGAGTCCCCACCTGCAAGAAGG - Intronic
1199963268 X:152796607-152796629 AAGACTCTCCACCATCAAAATGG + Intergenic
1199997579 X:153035767-153035789 GAGAGTCCCCACCATCAAGAAGG + Intergenic
1200815668 Y:7529629-7529651 CAGTGACTCCAACAGCAAGTAGG - Intergenic
1201391217 Y:13499456-13499478 CAGAGTTCCCACCAGCAAGAAGG - Intergenic
1201467084 Y:14294368-14294390 TGCAGTCTCCACCAGCAAGAGGG + Intergenic