ID: 1040454756

View in Genome Browser
Species Human (GRCh38)
Location 8:47585706-47585728
Sequence GACTCTGCAGAGTCTTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040454755_1040454756 -7 Left 1040454755 8:47585690-47585712 CCTTCTTGCTGGTGGAGACTCTG 0: 8
1: 74
2: 182
3: 317
4: 509
Right 1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040454756 Original CRISPR GACTCTGCAGAGTCTTGAGA TGG Intronic
No off target data available for this crispr