ID: 1040456047

View in Genome Browser
Species Human (GRCh38)
Location 8:47599017-47599039
Sequence CCCAACCAGCACTCCCCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040456043_1040456047 8 Left 1040456043 8:47598986-47599008 CCCATGGGCACAAAGAAGCAAAA 0: 1
1: 0
2: 4
3: 37
4: 533
Right 1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1040456044_1040456047 7 Left 1040456044 8:47598987-47599009 CCATGGGCACAAAGAAGCAAAAC 0: 1
1: 0
2: 1
3: 33
4: 226
Right 1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1040456039_1040456047 29 Left 1040456039 8:47598965-47598987 CCACTACAGGGACAGCCTGGACC 0: 1
1: 0
2: 2
3: 20
4: 200
Right 1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 166
1040456042_1040456047 14 Left 1040456042 8:47598980-47599002 CCTGGACCCATGGGCACAAAGAA 0: 1
1: 0
2: 1
3: 11
4: 166
Right 1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040456047 Original CRISPR CCCAACCAGCACTCCCCTGA GGG Exonic
900626317 1:3610316-3610338 CCCGTCCAGCACTCCCCAGCAGG - Intronic
901175461 1:7295409-7295431 CACAACAAGCCCTCCCCTCAGGG - Intronic
904130484 1:28272195-28272217 CCCTACAACCTCTCCCCTGATGG + Intronic
905452897 1:38068439-38068461 TCCCACCAGCCCTCCCCTGCAGG - Intergenic
905473046 1:38207391-38207413 GCCACCAAGCACTCCCCAGATGG - Intergenic
905533347 1:38699595-38699617 CTCAAACAGCACTCCCTGGATGG - Intergenic
905953886 1:41975949-41975971 CCCAGCCAGCACTTCCCTAAGGG + Intronic
906078773 1:43070057-43070079 CCCTCCCACCACTCCCCAGATGG + Intergenic
906500771 1:46340645-46340667 CCCAGCCAGGAGTCCCCTGAAGG - Exonic
907409090 1:54272319-54272341 CCCAGCCCAGACTCCCCTGAAGG + Intronic
908242440 1:62198694-62198716 CCCAACCCCCAGTCCCTTGAGGG + Intronic
912444606 1:109725547-109725569 CCCACTCAGCATTCCACTGAAGG + Intronic
914917263 1:151826305-151826327 CCCAGCCAGAACTACCCTGGCGG - Intronic
915739240 1:158105877-158105899 CCCAGACAGCACTGTCCTGAAGG - Intergenic
919664235 1:200277012-200277034 CCCAACCATCCCTCTACTGACGG + Intergenic
920091563 1:203456682-203456704 CCAATCCAGCACTCCCCTTTGGG - Intergenic
924259377 1:242213793-242213815 CCCACCAAACACTCCCCTGGAGG + Intronic
1067698461 10:48552208-48552230 TCCAACCAGCACCCCCAAGAGGG - Intronic
1068107322 10:52635045-52635067 CCCAACCACCACTCCCCAACAGG + Intergenic
1070685264 10:78475864-78475886 CTCATCCAGCTCTCCCATGATGG - Intergenic
1074225232 10:111478302-111478324 CCAAAGCAGCATTTCCCTGAGGG - Intergenic
1075292226 10:121240436-121240458 CCCAACCACCACTACCGAGATGG + Intergenic
1076742432 10:132493357-132493379 CCCTACCAGCACTCAGCTGATGG - Intergenic
1079209529 11:18448974-18448996 CCCACCCAGCAGTCCTCAGATGG + Intronic
1080347605 11:31342550-31342572 TCCACCCAGCACTCCTCTGTTGG + Intronic
1083526571 11:63371890-63371912 CCCAACCATGTCTCCCCTGATGG + Intronic
1084311101 11:68316835-68316857 CCCTCCCAGCACTCCTCTCAGGG - Intronic
1087972429 11:104500968-104500990 CCCAACCCTCACTCCCCAGCAGG - Intergenic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1091770158 12:3146191-3146213 CCTAGTCACCACTCCCCTGATGG - Intronic
1095943361 12:47740238-47740260 CCCATCCAGCACTCCCAGGAGGG + Intronic
1097902077 12:64883170-64883192 TCCAACAAGCTCTCCCCTCATGG - Intergenic
1101996324 12:109527789-109527811 CCCTACAAGCACCCCCCTAAAGG - Intronic
1102472918 12:113169754-113169776 CCCAGCCTCCACTCACCTGAGGG + Exonic
1104054614 12:125219867-125219889 CCCCAGCAGCCTTCCCCTGACGG + Intronic
1104492502 12:129207194-129207216 CCCAAACAGCACCGCCCTCACGG + Intronic
1113320785 13:109230090-109230112 CCCAACCCCCACTCTCCTGCTGG - Intergenic
1113864709 13:113513317-113513339 CCCACCCAGCAGTCCCCACAGGG + Intronic
1114414341 14:22530227-22530249 CCCAGCCAGAGCTCCCATGAGGG + Intergenic
1118854852 14:69612510-69612532 CCCAGCCACGACTCCCATGAGGG - Intronic
1119817046 14:77578939-77578961 CCCAACCAAGACTCACTTGAAGG + Exonic
1119904982 14:78293502-78293524 CCCATCCACCACTCTCCTAAAGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122628813 14:103098112-103098134 CCAAACCAGAACTTCGCTGAAGG - Intergenic
1122942809 14:104990000-104990022 CGCAACCAGCATTGCCCAGATGG + Intronic
1123224075 14:106883658-106883680 CCCAGCCACCACTCCCCTCCGGG + Intergenic
1124425469 15:29559239-29559261 ACCCACCAGCACTCACCAGAGGG + Intronic
1125320856 15:38486569-38486591 CCCAAGCAGCACTCCTATAAAGG - Exonic
1125328808 15:38563696-38563718 CCCATCCAGGTATCCCCTGAGGG - Intronic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1130037952 15:80378592-80378614 CCAAACCTGCTCTTCCCTGATGG - Exonic
1132233235 15:100200351-100200373 CCCTCCCAGCATTCCCCAGAGGG - Intronic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1134038705 16:11051566-11051588 CCCAACAGGCACGCCACTGACGG + Exonic
1134566446 16:15255964-15255986 CCAAACCAGCACTCACTTGGGGG + Intergenic
1134736050 16:16500735-16500757 CCAAACCAGCACTCACTTGGGGG - Intergenic
1134931474 16:18211435-18211457 CCAAACCAGCACTCACTTGGGGG + Intergenic
1135173046 16:20203488-20203510 CCCAAACAGAACTCCCTTTATGG - Intergenic
1136291539 16:29275421-29275443 CCCAAGCAGGACTCCCAAGATGG + Intergenic
1136375884 16:29864666-29864688 CACAGCCAGCACTCCCATGTGGG + Intergenic
1137597213 16:49732622-49732644 CACAACCTGCAAACCCCTGAGGG + Intronic
1139654096 16:68376989-68377011 CCCGACCACTCCTCCCCTGAGGG + Intronic
1141054349 16:80803112-80803134 GCCAGCCACCACTCCCCAGAGGG - Intronic
1142097417 16:88249350-88249372 CCCAAGCAGGACTCCCAAGATGG + Intergenic
1143742259 17:8963375-8963397 CTCAGCCAGCAGGCCCCTGATGG + Intronic
1143857335 17:9861889-9861911 CCCACCAATCAGTCCCCTGAGGG - Intronic
1148323460 17:46770913-46770935 CCCAACCATCTCTCTCCTCATGG + Intronic
1148333718 17:46827552-46827574 CCAAAGCAGGACTCCTCTGAAGG - Intronic
1148438519 17:47699756-47699778 CCCAGACACCACACCCCTGAGGG - Intronic
1148852996 17:50563719-50563741 CCCAACTACCACTCCCCTGGGGG - Intronic
1150248233 17:63691682-63691704 CTCCACCAGCCCTCCCCTGAGGG + Intronic
1152028384 17:77826478-77826500 CCCTACCAGCTCTCCACAGAGGG - Intergenic
1152540306 17:80971359-80971381 CCCAGCCCTCACTCCCCAGAAGG + Intergenic
1152740227 17:82015485-82015507 CCCAACCAGCACTGCCCCACGGG - Intronic
1153018631 18:606844-606866 CCCCACCAGCACCCCCCACAAGG + Intronic
1154107155 18:11533267-11533289 CCTAACCAGCCCCCCGCTGAAGG - Intergenic
1155491539 18:26405902-26405924 CCCAGCCATCACTCCCCAAAGGG + Intergenic
1156361367 18:36387167-36387189 CTCAAGCAGGACACCCCTGAGGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1159026027 18:63182906-63182928 TCCATCCTGCTCTCCCCTGATGG - Intronic
1160992511 19:1865495-1865517 ACCAACCAGCCCTGCCCTCAAGG + Intergenic
1162016733 19:7850310-7850332 TCCATGCAGCACTGCCCTGAAGG + Intronic
1163712205 19:18853522-18853544 TACAACCAGCTGTCCCCTGAAGG - Intronic
1165159819 19:33809487-33809509 CCCCACCAGCTCTCCCATGCAGG - Intronic
1165271860 19:34715426-34715448 CAAAACCAGCAATACCCTGATGG + Intergenic
1165325746 19:35113520-35113542 CCCAACCAGCACCCCTCTCATGG + Intergenic
1166537860 19:43586441-43586463 CACAACCAGCACTCCTCTATGGG + Exonic
1167033906 19:46981766-46981788 CCCCACCAGCTCTCACCGGAGGG + Intronic
1167081114 19:47276525-47276547 CCCCACCACCACTCCCCAGAGGG + Intergenic
1167692595 19:50995965-50995987 CCCATCCAGCCCTCCCCACAGGG + Intergenic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168414716 19:56160689-56160711 CCCAACCCCCAATCTCCTGAGGG - Exonic
926220920 2:10934940-10934962 CCCAGCCAGCCCTGCCCTCAGGG - Intergenic
930036522 2:47088944-47088966 CCCAACCAGCAGCCTCCCGAGGG - Intronic
930401307 2:50893004-50893026 CCAAACAAGAACTCCTCTGATGG + Intronic
931664125 2:64598170-64598192 CCTCACCATCCCTCCCCTGAAGG + Intergenic
931748439 2:65310563-65310585 CCCAACGAGCGCTCCTCAGAGGG - Intergenic
932268143 2:70386153-70386175 CCCCACCAGCTCACCCCTGCAGG + Intergenic
932698800 2:73978990-73979012 CCCCACCACCACTACCCTAATGG + Intergenic
935978031 2:108598563-108598585 CCCACCCACCACCCCCCAGATGG - Intronic
936135649 2:109891157-109891179 CCCACCCACCACCCCCCAGATGG - Intergenic
936209048 2:110480328-110480350 CCCACCCACCACCCCCCAGATGG + Intergenic
937064542 2:119007530-119007552 CACAAATAGCACTCACCTGATGG + Intergenic
937088230 2:119186210-119186232 CCCAACCAGCCTTTCCCTGGGGG + Intergenic
939012127 2:136858979-136859001 CCCAACCAGCATTTCCAGGAAGG - Intronic
940384711 2:153057579-153057601 CCAAACCTGCCCTCACCTGATGG - Intergenic
944253439 2:197600215-197600237 CCCAAACAGCACTCCCCATAGGG - Intronic
945775717 2:214103906-214103928 TCCAACCCCCACTCCCCAGAGGG - Intronic
947023560 2:225711352-225711374 CCTAACCAGCCCCACCCTGAGGG - Intergenic
948701798 2:239765272-239765294 CCCCACCATCACTGCCATGACGG + Intronic
948745421 2:240089389-240089411 CCCCACCCCCACTCCCCAGACGG + Intergenic
1172099703 20:32477817-32477839 TCCAACCCTCACTCCCTTGATGG + Intronic
1172448067 20:35003375-35003397 CCCACCCATCACCCCCTTGAGGG + Intronic
1173803520 20:45909905-45909927 CCCACTCTCCACTCCCCTGAGGG + Intronic
1175650229 20:60715422-60715444 CCCAAAGAGCACTAGCCTGAGGG - Intergenic
1176074275 20:63241383-63241405 CCCACCCAGCACCCCCCAGGCGG - Exonic
1181182104 22:21075583-21075605 CCCAACCAGCTCTGCCCAGATGG - Intergenic
1183474720 22:38029821-38029843 CACAACCAGGACTGACCTGATGG - Intronic
1184210099 22:43030387-43030409 CCCTTCCAGCCTTCCCCTGAGGG + Intergenic
1184665849 22:45988707-45988729 ACCGACCAGCACCGCCCTGATGG + Intergenic
1185084625 22:48733462-48733484 ACCATGCAGGACTCCCCTGAAGG - Intronic
1185342571 22:50298234-50298256 CCCAACCAGAACTCCGATGTAGG + Intronic
950428056 3:12935246-12935268 CCCCACCAGCAGTCCCAGGAGGG + Intronic
953610843 3:44446080-44446102 CCCAGCCAGAACTCCCCAGGGGG + Exonic
957402887 3:79739456-79739478 CCAAACTTGCACTCCCCTTAAGG - Intronic
966806947 3:183815289-183815311 CCCCACCAGCACTGCCAGGAAGG + Intergenic
968818054 4:2831855-2831877 CCGCACCACCACTCCCCGGACGG - Intronic
972204315 4:36753640-36753662 CTCAATCAGCCTTCCCCTGAGGG + Intergenic
972654142 4:41049387-41049409 CCCAGCCAGCCCTCCCCTCCGGG + Intronic
981673988 4:147319978-147320000 CCATACCTGCTCTCCCCTGAAGG + Intergenic
982228549 4:153187622-153187644 GCCAACCAGACCTCTCCTGAGGG + Intronic
984359574 4:178711351-178711373 CCCAACCAGGACGCCGCTGTAGG - Intergenic
984683877 4:182644103-182644125 CCCAGCCATCAGTCACCTGAAGG - Intronic
986192652 5:5511426-5511448 CCCATCCTGCACTCCCCAGAAGG + Intergenic
986854208 5:11849971-11849993 TACACCCAGCACTCCACTGATGG + Intronic
987924005 5:24317368-24317390 GCCAACCAGAACTCTCCTGTGGG + Intergenic
992829839 5:80583526-80583548 CCCCAGCACCACTCCCCAGATGG - Intergenic
998443921 5:142184306-142184328 CCACACCAGCACTCTCCTGGTGG + Intergenic
999086644 5:148898007-148898029 CCCCACCACCACTCCCATCATGG + Intergenic
1001531005 5:172461714-172461736 CCCAACTAGAACTCCCCTTGAGG + Intergenic
1002787994 6:418995-419017 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788006 6:419027-419049 CCCCACCAGCACCCCCATGTGGG + Intergenic
1002788030 6:419090-419112 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788044 6:419122-419144 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788057 6:419154-419176 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788071 6:419186-419208 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788085 6:419218-419240 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788098 6:419250-419272 CCCCACCAGCACCCCCATGCGGG + Intergenic
1002788112 6:419282-419304 CCCCACCAGCACCCCCATGCGGG + Intergenic
1004781723 6:18915820-18915842 ACCAACCTCCACTCTCCTGATGG - Intergenic
1006633070 6:35443190-35443212 CCCTAACACCACTCCCCAGAGGG - Intergenic
1007400301 6:41599246-41599268 CCCCACCAGCTCTCCCCACAGGG + Exonic
1014588855 6:123236041-123236063 CCCAACCATCTCACTCCTGAAGG - Intronic
1014602836 6:123436672-123436694 CCCAGCCTGCCCTCCCCAGACGG + Intronic
1015052380 6:128857522-128857544 CTGAATCAGCACTCCTCTGAAGG - Intergenic
1020926438 7:14332743-14332765 CCCAGCAAGGACTCCACTGATGG - Intronic
1021738072 7:23658407-23658429 CCCAAACAACACTGCCCTCAAGG + Intergenic
1022031784 7:26498466-26498488 ATCCACCAGCACTCCCCTGCTGG - Intergenic
1034670141 7:152851627-152851649 CCCAGCCAGCACTGCCCTCCAGG - Intronic
1035115228 7:156518166-156518188 ACCAACAAGCACACCTCTGACGG + Intergenic
1040456047 8:47599017-47599039 CCCAACCAGCACTCCCCTGAGGG + Exonic
1042835749 8:73078016-73078038 CCTAATCAGCACTTTCCTGAAGG - Intronic
1049465994 8:142751557-142751579 CCACAGCAGCACTTCCCTGATGG - Intronic
1050008186 9:1157023-1157045 CCCAACCAGCGATCCCTAGAGGG + Intergenic
1051053310 9:12955691-12955713 CCTAACCATCCCTCACCTGATGG - Intergenic
1051898251 9:22010607-22010629 CCTAACCAGCACTTCCATGGTGG - Intronic
1052822504 9:33148884-33148906 CCCAAAGACCATTCCCCTGAAGG + Intronic
1055090357 9:72358880-72358902 CACAACCAGAAGTGCCCTGATGG - Intronic
1058881654 9:109290568-109290590 CCCAGCCAGCAGTTCCCAGAAGG + Intronic
1059338417 9:113583582-113583604 CCCAACAAGGACTCCCCTTCTGG + Exonic
1188242632 X:27809461-27809483 CCCAACCACCACCCCCCCGCCGG + Intronic
1195676717 X:107512320-107512342 CCCCACCAGCTCTGCCCTCAGGG - Intergenic
1200397997 X:156002520-156002542 CCCAACCCTGACTCCCCTGCAGG + Intronic
1200824533 Y:7624213-7624235 CCCAACAAACACTCCCCTACAGG - Intergenic
1200976029 Y:9213060-9213082 CCCAGCAAACACTCCCCTAAAGG - Intergenic
1202135137 Y:21653475-21653497 CCCAGCAAACACTCCCCTAAAGG + Intergenic
1202235522 Y:22706874-22706896 CCCAACAAACACTCCCCTACAGG + Intergenic
1202307637 Y:23489294-23489316 CCCAACAAACACTCCCCTACAGG - Intergenic
1202563164 Y:26181292-26181314 CCCAACAAACACTCCCCTACAGG + Intergenic