ID: 1040456850 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:47606702-47606724 |
Sequence | CTAGACTCCTTTTGAAAAGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1040456847_1040456850 | 25 | Left | 1040456847 | 8:47606654-47606676 | CCTTTGCATGTGTTTGGACAGTG | 0: 1 1: 0 2: 2 3: 15 4: 175 |
||
Right | 1040456850 | 8:47606702-47606724 | CTAGACTCCTTTTGAAAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1040456850 | Original CRISPR | CTAGACTCCTTTTGAAAAGC TGG | Intronic | ||
No off target data available for this crispr |