ID: 1040456850

View in Genome Browser
Species Human (GRCh38)
Location 8:47606702-47606724
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040456847_1040456850 25 Left 1040456847 8:47606654-47606676 CCTTTGCATGTGTTTGGACAGTG 0: 1
1: 0
2: 2
3: 15
4: 175
Right 1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr