ID: 1040463139

View in Genome Browser
Species Human (GRCh38)
Location 8:47669441-47669463
Sequence CTGTGTGAGCAAAACAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040463134_1040463139 5 Left 1040463134 8:47669413-47669435 CCTGAGCCAGCCTGCCTCTGAGC 0: 1
1: 1
2: 3
3: 31
4: 404
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data
1040463132_1040463139 15 Left 1040463132 8:47669403-47669425 CCACCTCGGGCCTGAGCCAGCCT 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data
1040463137_1040463139 -9 Left 1040463137 8:47669427-47669449 CCTCTGAGCTGCAGCTGTGTGAG 0: 1
1: 0
2: 3
3: 31
4: 361
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data
1040463133_1040463139 12 Left 1040463133 8:47669406-47669428 CCTCGGGCCTGAGCCAGCCTGCC 0: 1
1: 0
2: 3
3: 42
4: 619
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data
1040463136_1040463139 -5 Left 1040463136 8:47669423-47669445 CCTGCCTCTGAGCTGCAGCTGTG 0: 1
1: 0
2: 14
3: 63
4: 524
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data
1040463135_1040463139 -1 Left 1040463135 8:47669419-47669441 CCAGCCTGCCTCTGAGCTGCAGC 0: 1
1: 0
2: 7
3: 56
4: 539
Right 1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040463139 Original CRISPR CTGTGTGAGCAAAACAGAGT GGG Intronic
No off target data available for this crispr