ID: 1040466478

View in Genome Browser
Species Human (GRCh38)
Location 8:47700340-47700362
Sequence CACTGGCCAAGTACTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040466474_1040466478 20 Left 1040466474 8:47700297-47700319 CCATGGCCTTAGGCATTAGAGTC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1040466478 8:47700340-47700362 CACTGGCCAAGTACTCAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 93
1040466475_1040466478 14 Left 1040466475 8:47700303-47700325 CCTTAGGCATTAGAGTCTGTTAA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1040466478 8:47700340-47700362 CACTGGCCAAGTACTCAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040466478 Original CRISPR CACTGGCCAAGTACTCAGTA AGG Intronic
906777018 1:48539026-48539048 CTCTGGCCAAGTCCTCAGACAGG + Intronic
909049896 1:70754264-70754286 CACTGGCAAAGTACCCAGGTGGG + Intergenic
909105366 1:71399758-71399780 CACTTGTCAAGTACTTGGTAGGG + Exonic
911647833 1:100354155-100354177 CACAGGCCAATTACTGAGTCTGG - Intronic
912414040 1:109496114-109496136 TTCTGGGCATGTACTCAGTATGG + Exonic
918635271 1:186766589-186766611 CCCTGGCCAGGTACTCAAGATGG + Intergenic
1063216641 10:3931486-3931508 CACAGGCCACGCACCCAGTAAGG + Intergenic
1072230056 10:93407119-93407141 AACAGGCTAAGTTCTCAGTATGG + Intronic
1073167196 10:101466228-101466250 CACTGCCCACGTTCTCAGGATGG - Intronic
1079457555 11:20650358-20650380 CACTGGCCAAGTCTTCAGAGGGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084312507 11:68325129-68325151 CACTGGTTAAGTACCCAGAAGGG - Intronic
1085528455 11:77177433-77177455 CACAGGTCAAGAACTCAGTTGGG - Intronic
1087777905 11:102273555-102273577 CCCTGGCTAAGGACTCAGTGTGG + Intergenic
1090422931 11:126588186-126588208 CACTGGCCAAGAGCTCAGATGGG + Intronic
1091565563 12:1645699-1645721 CACAGGCCTAGTACACAGGAGGG - Intronic
1091822110 12:3483190-3483212 CACAGGCCAAGTACCCACTGCGG - Intronic
1098030822 12:66252026-66252048 CACTGACGAAGCACTCAGGATGG + Exonic
1100293827 12:93242243-93242265 CATTTGACAAGTACTTAGTATGG + Intergenic
1100883704 12:99046104-99046126 CATTGGTCAAGTACTCAGAAGGG + Intronic
1104383183 12:128326023-128326045 TACTGGCCATGTCCTGAGTATGG - Intronic
1110268386 13:73565754-73565776 CATTAGCCAAGTACTCTGTTAGG + Intergenic
1115387580 14:32815485-32815507 CACTTGCCCAGTCCTCAGCAAGG - Intronic
1116938483 14:50767140-50767162 CAAGGGCCCAGTACCCAGTATGG - Intronic
1117721420 14:58632155-58632177 CACGGGCCAGGAAATCAGTATGG + Intergenic
1119085831 14:71738106-71738128 CAATGTCAAATTACTCAGTATGG - Intronic
1119640216 14:76309116-76309138 CACTGGCCTGGTACTCAGAAGGG + Intergenic
1120733234 14:88025668-88025690 CAATGACCTAGTAGTCAGTAAGG - Intergenic
1133522228 16:6569765-6569787 CACTGGCCAACCACTCAGGAAGG - Intronic
1135659211 16:24279938-24279960 CACTGCCCAAGAACTCATGAGGG + Intronic
1138440009 16:57028517-57028539 ATCAGTCCAAGTACTCAGTAGGG + Intronic
1139625759 16:68187415-68187437 CACAGGACAAGAACTCAGTGGGG - Intronic
1140888402 16:79264389-79264411 CAATGGCCAAGTCATCAGTTAGG + Intergenic
1140922166 16:79549587-79549609 CACTGGCCATGTCCTCAGTGTGG + Intergenic
1141808051 16:86354968-86354990 CACTGTCCAAGTGATCAGTCAGG + Intergenic
1143381776 17:6501190-6501212 CTCTGGCCAGGTGCTCAGAAGGG + Intronic
1143407614 17:6687932-6687954 CACAGTCTAAGTACTCAGCATGG - Intronic
1149924919 17:60693389-60693411 AACTGGCCAAGTATGAAGTATGG - Intronic
1150128050 17:62651460-62651482 CACTGGCCAAGTGCCCACTGAGG - Intronic
1150874733 17:68957580-68957602 TACAGGCCAAGGACTCAGCATGG - Intergenic
1151754453 17:76065023-76065045 CACTTACTAAGTGCTCAGTAAGG + Intronic
1158383318 18:56959953-56959975 CACTTCCCAAGTATTCACTATGG - Intronic
928230617 2:29495464-29495486 CACTAGCCCAGTCCTCAGTGGGG - Intronic
928253467 2:29701705-29701727 CACTCGCCAAGGACTCACTGGGG + Intronic
931721732 2:65071903-65071925 CACAGGCCCAGTACTCAGCCTGG - Exonic
931973773 2:67619976-67619998 GACTGGCCAAGCACTCTTTAGGG + Intergenic
933449265 2:82425486-82425508 CACTCTCCAAGTTCTCAGCATGG + Intergenic
935305191 2:101730598-101730620 CACTGGACAGGTGTTCAGTACGG + Intronic
939366393 2:141237871-141237893 CACTTGCCACGTGCTAAGTAAGG - Intronic
939958816 2:148548321-148548343 CAATAGGCAAGCACTCAGTAGGG - Intergenic
947919678 2:233858651-233858673 CACAGGCCAATCACTCAGTCTGG - Intergenic
948625692 2:239266597-239266619 CACTGGCCAAGAAATCATCATGG + Intronic
948682598 2:239646140-239646162 CACTGGGTAAGCACTCAGAAGGG - Intergenic
1168907253 20:1416336-1416358 CACTGGCTAGGCACACAGTAGGG + Intergenic
1173956375 20:47036065-47036087 TACTGGCCAAGTGCTCAGCCTGG - Intronic
1174706731 20:52663981-52664003 CAATGGCCAAATCCTCAGCAAGG - Intergenic
1174776111 20:53344417-53344439 CAGTGGCCAAGCAGACAGTATGG - Intronic
1175282241 20:57811711-57811733 CCAGGGCCAAGTACTCAGTAGGG - Intergenic
1180074519 21:45455926-45455948 CCCTGGCCAAGCTCTCAGTGGGG - Exonic
1184189653 22:42886180-42886202 CACAGGCCAGGTACTCAGCAGGG + Intronic
949419614 3:3851861-3851883 TACAGGCCAAGCGCTCAGTACGG - Intronic
950329805 3:12147339-12147361 CAATGGACAAGTAGTCAGGAGGG + Intronic
953428122 3:42812551-42812573 CACTGGGCTAGTTCTCAGGAAGG - Intronic
956887420 3:73574309-73574331 CCATGGTCAAGTACTCAGTTTGG - Intronic
957668433 3:83268085-83268107 CTATGGCCAAGGACTCAGTGTGG - Intergenic
961170296 3:124793056-124793078 CCCTGGCCTGGTACTCGGTAGGG - Intronic
969454386 4:7292812-7292834 CACTGCCCAAGTTCACAGCAAGG - Intronic
974638183 4:64592355-64592377 CACTGGCAAATTTCTCAGCACGG - Intergenic
975333675 4:73150346-73150368 CACAGGCCATTTCCTCAGTAGGG + Intronic
976131059 4:81884371-81884393 TACTGGCCCTGTAATCAGTATGG - Intronic
977885142 4:102245117-102245139 CAGTGGGCATGTACTCAGAACGG + Intergenic
979526973 4:121727777-121727799 TACTGGGCAAGTATTCACTATGG + Intergenic
981492892 4:145359550-145359572 CACTGGACAAGTTCCCATTAAGG + Intergenic
987151493 5:15045265-15045287 CACTAGCCTGGTGCTCAGTAGGG + Intergenic
999121123 5:149210148-149210170 CATTTGCTGAGTACTCAGTATGG + Intronic
1002341100 5:178517008-178517030 CACTGGGCCAGGACTCAGTGGGG + Intronic
1013046648 6:106492256-106492278 CACCTACCATGTACTCAGTATGG - Intergenic
1016395785 6:143622041-143622063 CACTGCCCAAGGCCTCAGTGGGG - Intronic
1026528958 7:71180840-71180862 CAGAGGCCAAGAACTCAGTTTGG + Intronic
1028370542 7:90087158-90087180 CACTGGCAAAGCACTCAGACTGG - Intergenic
1040466478 8:47700340-47700362 CACTGGCCAAGTACTCAGTAAGG + Intronic
1040482743 8:47841480-47841502 CACTGGCAAAGCACTCAGGCTGG - Intronic
1042154954 8:65834546-65834568 CACTTGCCAAGTACTTTATATGG + Intronic
1044468865 8:92541436-92541458 CACTGACCAAGCACTGAGCAAGG - Intergenic
1044841348 8:96339576-96339598 CACTGGCCAAATACTTTGAAAGG + Intergenic
1049700403 8:144008649-144008671 CACTGTCCAAGAGCTCAGAAGGG + Intronic
1050112205 9:2228557-2228579 CACTGGCCTAGTGCATAGTAAGG + Intergenic
1051560285 9:18433585-18433607 AACTGGGCAACTACTCAGAAAGG + Intergenic
1053140899 9:35682149-35682171 CACTGGCCAAGGTCTCTGTGAGG + Exonic
1054464391 9:65484891-65484913 CATAGGCAAAGTACCCAGTATGG + Intergenic
1188508925 X:30912632-30912654 CACAGGCCAAGTACCCAATGTGG - Intronic
1191995537 X:67091307-67091329 CACAGGCCAAGTTCTCAGAGAGG - Intergenic
1192396857 X:70790756-70790778 CACTGGCAAAGCACTCAGGCAGG - Intronic
1192953544 X:76044017-76044039 CACTGGCCAGATGCTCAGAAAGG + Intergenic
1194959246 X:100215895-100215917 CACTGGGCATGTACTCAGGCAGG + Intergenic
1196759740 X:119190463-119190485 CACAGGGCAGGCACTCAGTAAGG - Intergenic
1197944618 X:131825859-131825881 CATTCGCCAAGTCCTCAATAGGG - Intergenic
1198922230 X:141742657-141742679 AACTGGCAAAGTTCTCATTAAGG + Intergenic
1199670887 X:150147304-150147326 AACTCGCCAAGTACTAAGGAGGG - Intergenic
1201054939 Y:9979159-9979181 CTTTGGCCAGGTACGCAGTAAGG - Intergenic