ID: 1040467273

View in Genome Browser
Species Human (GRCh38)
Location 8:47706600-47706622
Sequence AAGGATCGACGTGGCTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040467273_1040467276 -4 Left 1040467273 8:47706600-47706622 CCTTTATAGCCACGTCGATCCTT 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1040467276 8:47706619-47706641 CCTTTTTTCATCCCTAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040467273 Original CRISPR AAGGATCGACGTGGCTATAA AGG (reversed) Intronic
901959593 1:12814471-12814493 TAGGATTGACTTGGCTATATGGG + Intergenic
902144211 1:14383777-14383799 TAGGATTGACTTGGCTATATGGG + Intergenic
906970922 1:50512696-50512718 TAGGATTGTCTTGGCTATAACGG + Intronic
909146395 1:71938881-71938903 AAGAATGGACCTGGCTACAAGGG - Intronic
916830497 1:168485887-168485909 AAGGATTGTCTTGGCTATAAGGG - Intergenic
917110450 1:171542126-171542148 CAGAATCGACGTGGCAACAATGG + Exonic
917915673 1:179698976-179698998 CAGGATTGTCTTGGCTATAAGGG - Intergenic
918163550 1:181923171-181923193 TAGGATTGTCTTGGCTATAAGGG - Intergenic
919077275 1:192829076-192829098 TAGGATCGTCTTGGCTATATGGG - Intergenic
921439118 1:215162889-215162911 TAGGATCGTCTTGGCTATATGGG + Intronic
922379616 1:225009566-225009588 TAGGATTGTCTTGGCTATAAAGG + Intronic
923943326 1:238854282-238854304 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1066014795 10:31230136-31230158 TAGGATCGTCTTGGCTATACGGG + Intergenic
1067005547 10:42657427-42657449 AAGGATCAATGTTGCTAAAATGG + Intergenic
1073625234 10:105089946-105089968 AAGGATGGATGTGGCTGTAATGG - Intronic
1074635926 10:115317353-115317375 TAGGATCGTCTTGGCTATATGGG + Intronic
1081093932 11:38908306-38908328 CAGGATTGTCTTGGCTATAAGGG - Intergenic
1089753902 11:120672086-120672108 TAGGATCGTCTTGGCTATACGGG + Intronic
1093905397 12:24685333-24685355 AAGGATTGTCTTGGCTATACGGG + Intergenic
1095217328 12:39565090-39565112 TAGGATCGACTTGGCAATATGGG + Intronic
1098791683 12:74832129-74832151 AAGAATCAATGTGGCTAAAACGG + Intergenic
1099943778 12:89221427-89221449 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1101551575 12:105767404-105767426 TAGGATCGTCTTGGCTATATGGG + Intergenic
1103047159 12:117746111-117746133 TAGGATTGTCTTGGCTATAAGGG - Intronic
1107661212 13:42641604-42641626 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1109533437 13:63684202-63684224 AAGGATTGTCTTGGCTATGAGGG + Intergenic
1111307063 13:86428342-86428364 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1111682805 13:91464689-91464711 AAAGGTGGACGTGTCTATAAAGG + Intronic
1115720672 14:36157717-36157739 TAGGATTGTCTTGGCTATAATGG + Intergenic
1116771025 14:49127301-49127323 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1117614051 14:57514929-57514951 AAGGATTGTCTTGGCTATATGGG + Intergenic
1124791122 15:32728167-32728189 TAGGATCGTCTTGGCTATACCGG - Intronic
1125329582 15:38569076-38569098 TAGGATTGTCTTGGCTATAAAGG + Intergenic
1126853779 15:52817501-52817523 TAGGATCGTCTTGGCTATATGGG + Intergenic
1127374163 15:58367591-58367613 AAGGATTGTCTTGGCTATATGGG - Intronic
1133857678 16:9564906-9564928 AAGGATTGAGGTGGCTTTGACGG - Intergenic
1135921966 16:26658687-26658709 AAGGATGCACGTGGCTATAGAGG - Intergenic
1156241733 18:35261313-35261335 TAGGATTGTCTTGGCTATAAGGG + Intronic
1157657645 18:49407207-49407229 GAGGATGGGTGTGGCTATAAAGG + Intronic
1158398614 18:57099899-57099921 AAGGATTGTCTTGGCTATATGGG + Intergenic
1160275380 18:77428406-77428428 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1164341059 19:24398477-24398499 TAGGATTGACGTGGCTATGTGGG - Intergenic
926755467 2:16231621-16231643 TAGGATTGACTTGGCAATAAGGG + Intergenic
926909989 2:17843546-17843568 AAGGGTAGACTTGGCCATAATGG + Intergenic
927044042 2:19259190-19259212 TAGGATTGACTTGGCAATAAGGG + Intergenic
930275787 2:49309784-49309806 ATGGACAGACATGGCTATAAAGG + Intergenic
933305705 2:80595825-80595847 TAGGATCGTCTTGGCTATACAGG + Intronic
936176548 2:110227598-110227620 TAGGATTGTCTTGGCTATAAGGG + Intergenic
939937339 2:148309115-148309137 AAGGATTGACTTGGCTATATGGG + Intronic
939941401 2:148355741-148355763 AAGGATTGTCTTGGCTATACAGG + Intronic
939947594 2:148428524-148428546 TAGGATTGTCTTGGCTATAAGGG - Intronic
944094268 2:195948753-195948775 TAGGATTGTCTTGGCTATAAGGG + Intronic
944934967 2:204558721-204558743 TAGGATTGACTTGGCAATAAGGG - Intronic
947335447 2:229077846-229077868 TAGGATTGTCTTGGCTATAAAGG + Intronic
948388190 2:237594706-237594728 AAGGACTGACTTGGCTAGAAAGG - Intronic
1170294661 20:14811117-14811139 TAGGATTGACTTGGCTATATGGG - Intronic
1177269109 21:18822377-18822399 TAGGATTGTCGTGGCTATACAGG + Intergenic
1178739434 21:35184243-35184265 TAGGATCGTCTTGGCTATATGGG + Intronic
950886421 3:16366556-16366578 AAGGAAAGACGTGGCTATGCTGG - Intronic
951653318 3:24977222-24977244 CAGGATTGACTTGGCTATATGGG + Intergenic
953265992 3:41388836-41388858 TAGGATTGACTTGGCTATACAGG + Intronic
953581269 3:44159065-44159087 AGGGATGCATGTGGCTATAAAGG - Intergenic
954950957 3:54473062-54473084 TAGGATTGACTTGGCTATACGGG - Intronic
957241419 3:77665570-77665592 AAGGATTGACTTGGCTATCCAGG + Intergenic
957426521 3:80046520-80046542 TAGGATTGTCTTGGCTATAAGGG - Intergenic
958458757 3:94367158-94367180 TAGGATTGCCGTGGCTATTAGGG + Intergenic
960250389 3:115445166-115445188 TAGGATTGACTTGGCTATATGGG - Intergenic
960745278 3:120881077-120881099 TAGGATCGTCATGGCTATACAGG - Intergenic
962446001 3:135466059-135466081 TAGGATTGTCTTGGCTATAAGGG - Intergenic
963532453 3:146487853-146487875 TAGGATTGTCTTGGCTATAAGGG - Intronic
964232904 3:154491449-154491471 CAGGATCGTCTTGGCTATACGGG - Intergenic
964571748 3:158114458-158114480 AAGGATTGTCTTGGCTATATGGG + Intronic
966532819 3:180999640-180999662 TAGGATTGTCGTGGCTATACAGG + Intergenic
966559684 3:181306422-181306444 TAGGATTGTCTTGGCTATAAGGG - Intergenic
967758620 3:193198651-193198673 TAGGATTGACTTGGCTATATGGG + Intergenic
973629516 4:52806677-52806699 TAGGATTGACTTGGCTATATGGG - Intergenic
974966694 4:68769672-68769694 TAGGATTGACTTGGCTATGAGGG + Intergenic
977477293 4:97528461-97528483 TAGGATTGTCTTGGCTATAAGGG + Intronic
977481751 4:97587019-97587041 AATTATCAAAGTGGCTATAAAGG + Intronic
987892185 5:23893392-23893414 AAGGATTGCCTTGGCTATACAGG + Intergenic
987988115 5:25176552-25176574 TAGGATCGTCTTGGCTATACAGG + Intergenic
988423791 5:31039033-31039055 TAGGATTGTCTTGGCTATAAGGG - Intergenic
996006344 5:118425201-118425223 AAGGATTGCCTTGGCTATACAGG - Intergenic
997623101 5:135313180-135313202 AAGGAACGATGTGGTTAGAAAGG + Intronic
997804288 5:136899568-136899590 TAGGATCGTCTTGGCTATACGGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998294595 5:140955237-140955259 TAGGATCGGCTTGGCTATAAAGG + Intronic
1009384460 6:63071738-63071760 TAGGATTGACTTGGCTATGAGGG + Intergenic
1012679969 6:102167995-102168017 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1014422756 6:121265606-121265628 TAGGATTGACTTGGCTATATGGG - Intronic
1015406836 6:132846993-132847015 AAGGATTGACTTGGCAATGAGGG - Intergenic
1020752995 7:12166345-12166367 TAGGATCGCCTTGGCTATACGGG + Intergenic
1021363788 7:19750704-19750726 AAGGATAGAACTGCCTATAAAGG - Intronic
1024915960 7:54500193-54500215 TAGGATTGACGTGGCGATGAGGG + Intergenic
1031063531 7:117078151-117078173 AAGGTTCCATGTGGCTAGAAGGG + Intronic
1031092694 7:117379036-117379058 AAGGTTAGATGTGGCTATAAAGG + Intronic
1031578782 7:123446650-123446672 TAGGATTGACGTGGCGATGAGGG + Intergenic
1037032448 8:14125658-14125680 TAGGATTGTCTTGGCTATAAGGG - Intronic
1039385416 8:37131342-37131364 CAGGATAGATGTGTCTATAAAGG + Intergenic
1040467273 8:47706600-47706622 AAGGATCGACGTGGCTATAAAGG - Intronic
1041274032 8:56139380-56139402 TAGGATTGACCTGGCTATACGGG + Intergenic
1041625662 8:60023645-60023667 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1043227821 8:77754649-77754671 AAGGTTCTAAATGGCTATAAGGG + Intergenic
1046171590 8:110515207-110515229 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1050004110 9:1109941-1109963 TAGGATTGTCTTGGCTATAAGGG + Intergenic
1050032179 9:1398029-1398051 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1051007005 9:12357401-12357423 AAGGAGCTAGGTGGCTGTAATGG - Intergenic
1056015370 9:82380533-82380555 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1057712207 9:97456354-97456376 TAGGATTGTCTTGGCTATAAGGG - Intronic
1058212316 9:102184468-102184490 TAGGATCGTCTTGGCTATACAGG + Intergenic
1186161063 X:6777790-6777812 AAGTATAGACCTTGCTATAAAGG - Intergenic
1188785814 X:34345114-34345136 TAGGATCGCCTTGGCTATACGGG - Intergenic
1191003114 X:55682617-55682639 TAGGATCGACTTGGCGATGAGGG + Intergenic
1191895024 X:65983425-65983447 TAGGATCGTCTTGGCTATAAGGG - Intergenic
1192228250 X:69244656-69244678 TAGGATTGTCTTGGCTATAAAGG + Intergenic
1192228834 X:69249729-69249751 TAGGATTGTCTTGGCTATAAAGG - Intergenic
1192599630 X:72448114-72448136 TAGGATTGTCTTGGCTATAAGGG - Intronic
1192601280 X:72467057-72467079 AGGGATGGATGTAGCTATAAAGG + Intronic
1193955785 X:87860246-87860268 AAGGATTGTCTTGGCTATACAGG + Intergenic
1194287212 X:92024693-92024715 TAGGATTGTCTTGGCTATAAGGG - Intronic
1194625198 X:96219194-96219216 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1194643118 X:96427056-96427078 TAGGATCGTCTTGGCTATACTGG + Intergenic
1195225898 X:102792873-102792895 TAGGATTGTCGTGGCTATACAGG + Intergenic
1195825889 X:109000211-109000233 TAGGATCGTCTTGGCTATATGGG + Intergenic
1196985847 X:121269827-121269849 TAGGATTGTCTTGGCTATAAGGG - Intergenic
1197293381 X:124687130-124687152 TAGGATTGTCGTGGCTATATGGG - Intronic
1197574597 X:128195678-128195700 ATGGATTGTCTTGGCTATAATGG + Intergenic
1197589517 X:128391190-128391212 TAGGATCGTCTTGGCTATATGGG - Intergenic
1198680337 X:139174857-139174879 TAGGATTGACTTGGCTATACAGG + Intronic
1199027269 X:142954716-142954738 TAGGATCGTCTTGGCTATATGGG + Intergenic