ID: 1040468432

View in Genome Browser
Species Human (GRCh38)
Location 8:47716575-47716597
Sequence GATAATGCTCAGGAGGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040468428_1040468432 5 Left 1040468428 8:47716547-47716569 CCTCAAAACACTGTTGAGAATTA 0: 1
1: 0
2: 2
3: 24
4: 320
Right 1040468432 8:47716575-47716597 GATAATGCTCAGGAGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040468432 Original CRISPR GATAATGCTCAGGAGGCTTT GGG Intronic
No off target data available for this crispr