ID: 1040470439

View in Genome Browser
Species Human (GRCh38)
Location 8:47731784-47731806
Sequence TGGGCAGTTCCCCCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040470439_1040470447 17 Left 1040470439 8:47731784-47731806 CCCAGAAAGGGGGGAACTGCCCA 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1040470447 8:47731824-47731846 GTTTGAGTAGGTGCTAAAGGTGG No data
1040470439_1040470444 5 Left 1040470439 8:47731784-47731806 CCCAGAAAGGGGGGAACTGCCCA 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1040470444 8:47731812-47731834 GACCAGGTAGAAGTTTGAGTAGG No data
1040470439_1040470446 14 Left 1040470439 8:47731784-47731806 CCCAGAAAGGGGGGAACTGCCCA 0: 1
1: 0
2: 2
3: 27
4: 214
Right 1040470446 8:47731821-47731843 GAAGTTTGAGTAGGTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040470439 Original CRISPR TGGGCAGTTCCCCCCTTTCT GGG (reversed) Intronic
901888252 1:12239475-12239497 TGGGCAGGTCCCCACATTCGAGG + Intronic
905658485 1:39701832-39701854 TTGGCTGTTCAACCCTTTCTGGG + Intronic
907587922 1:55638020-55638042 TGGCCAGTGCACCCCTTACTGGG + Intergenic
909495533 1:76273523-76273545 TAGGAAGTTCCACCTTTTCTTGG - Intronic
910369794 1:86503580-86503602 TGGGCAGGTTGCCCCTTTCTGGG + Intergenic
912018530 1:105072861-105072883 TGGGCAATTCCCCTCTGCCTAGG + Intergenic
912620015 1:111145837-111145859 TGGCAGGTTCCCCCCTGTCTGGG - Intronic
918176443 1:182050406-182050428 TAGGAATTTCTCCCCTTTCTAGG + Intergenic
918752592 1:188290957-188290979 GGGGCATTTCCCCCTTTGCTCGG - Intergenic
919473253 1:198004760-198004782 AGGGCACTTTCCCACTTTCTGGG - Intergenic
921720303 1:218463813-218463835 TGGCCAGCTGCCCTCTTTCTTGG + Intergenic
921724232 1:218506727-218506749 GGGGCTTTTCCCCCTTTTCTTGG + Intergenic
923886717 1:238165256-238165278 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
924415585 1:243852915-243852937 TTGGTACTTCCCCCATTTCTTGG + Intergenic
924481568 1:244439836-244439858 TGGGCAATTCCCCTCTGGCTAGG + Intronic
924709109 1:246519496-246519518 TGGGCAGGGTCCCCCATTCTAGG - Intergenic
924869981 1:248031462-248031484 TGGGCAGTGCTTCCCCTTCTGGG + Intronic
1064700039 10:18009242-18009264 TGTCCAGTTCCCCCCATTGTAGG - Intronic
1065432060 10:25668995-25669017 TGTGCATTTCCCCAATTTCTTGG - Intergenic
1069903842 10:71720823-71720845 TGGGCAGGTCACACCTCTCTGGG - Intronic
1070059495 10:72968242-72968264 TGGGCACTTCCCCTCTGGCTAGG + Intergenic
1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG + Intronic
1071300507 10:84252922-84252944 TGGGCAGCTCTGCCCCTTCTGGG + Exonic
1071896832 10:90076711-90076733 TGGGCAATTCCCCTCTGGCTGGG + Intergenic
1075389867 10:122084406-122084428 TGCCCAGCACCCCCCTTTCTGGG - Exonic
1077860350 11:6172523-6172545 TGGGCAGTAACCTCCTTTCCAGG - Intergenic
1079760132 11:24319031-24319053 TGGGCAATTCCCCTCTAGCTAGG + Intergenic
1080058366 11:27931281-27931303 TGGGCTGATTCCCTCTTTCTGGG - Intergenic
1080878292 11:36296396-36296418 AGGGCAGGTCCCACCTTGCTGGG - Intronic
1083749042 11:64751311-64751333 TTGGCAGCACCCACCTTTCTCGG + Exonic
1084332988 11:68440499-68440521 TGGGGAGAACCCCCGTTTCTGGG + Intronic
1084878209 11:72149803-72149825 TGGGCTGATTCCCCCTTTTTTGG + Intergenic
1085395177 11:76203510-76203532 TGGGCTGTCCACCCCCTTCTTGG - Intronic
1085424518 11:76392050-76392072 TGGGCAGTGCCCAGCTTTGTGGG + Intronic
1085777607 11:79380651-79380673 TGGGAAATTCCCCTCCTTCTTGG - Intronic
1085929873 11:81069059-81069081 TGGACAATTCCCTTCTTTCTGGG + Intergenic
1086530377 11:87777944-87777966 AAGGCTGTTTCCCCCTTTCTAGG + Intergenic
1086838319 11:91653433-91653455 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
1086978743 11:93169392-93169414 TGGGCAGGGCCCTCCTTTCTGGG - Intronic
1087007487 11:93483832-93483854 TGGACAGTCCCCACCTTCCTGGG + Intronic
1087346312 11:96975659-96975681 TGGGCAGTTTCCCCACTTCCTGG - Intergenic
1088274033 11:108065482-108065504 TGGGCGATTCCCCTCTGTCTAGG + Intronic
1090011394 11:123048765-123048787 TGGACAGTTCCCTCCTTTAAAGG + Intergenic
1091275952 11:134350307-134350329 TGGGCAGTTCCTCTCTGGCTAGG + Intronic
1091624025 12:2109036-2109058 TTTGCAGTTCTTCCCTTTCTAGG + Intronic
1094700394 12:32864897-32864919 TGAGAAGTTGGCCCCTTTCTGGG + Intronic
1098132147 12:67362035-67362057 TGAGCAGTCCCCAGCTTTCTAGG - Intergenic
1098667423 12:73181020-73181042 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
1100933766 12:99639667-99639689 GGGGCATTTCCCCCTTTGCTCGG + Intronic
1101252084 12:102946447-102946469 TGGGCAGTTCTCCTCTGGCTAGG + Intronic
1103635050 12:122297804-122297826 TGCACAGATCCCCCTTTTCTAGG + Intronic
1105029815 12:132874598-132874620 TGGGCAGTCCCGCCTGTTCTGGG - Intronic
1105069731 12:133227240-133227262 TGGGCTGTCACCCCCTTTCTTGG - Intronic
1106979000 13:35255676-35255698 TGGGCTGTGACACCCTTTCTGGG - Intronic
1107524302 13:41214589-41214611 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
1107667830 13:42711121-42711143 TGGACAGTACCCCACTTTCAAGG - Intergenic
1107800234 13:44099602-44099624 GGGGCAGATCCCCCATGTCTTGG - Intergenic
1108879139 13:55087516-55087538 TGGGCTTTTCCCCTCTCTCTAGG + Intergenic
1110384185 13:74889496-74889518 TGAGCAGTTACACCCTGTCTGGG + Intergenic
1112805141 13:103156535-103156557 TGGGTGGTGCCCCACTTTCTCGG + Intergenic
1113991126 14:16029168-16029190 TGGGCAATTCCCTCATTCCTTGG + Intergenic
1114980203 14:28154464-28154486 TGGGCTCTTCACCCATTTCTGGG + Intergenic
1115467627 14:33733006-33733028 TTGGTAGTTCCTCCCTTACTGGG + Intronic
1116183788 14:41569854-41569876 AGGGCTTTTCCCCCTTTTCTTGG - Intergenic
1117605567 14:57425089-57425111 AGAGCAGTTCTCCTCTTTCTTGG + Intergenic
1118241267 14:64060833-64060855 TGGGCAGTTGCCCTCTGGCTAGG + Intronic
1118867022 14:69711987-69712009 TGGGCAGGTTGCCCCTTTCTGGG + Exonic
1119593213 14:75909509-75909531 TGTGCAGTGACCCCCTCTCTGGG + Intronic
1119749670 14:77068305-77068327 TGGGCAGTGCCCCCCTACCTGGG + Intergenic
1121618643 14:95331201-95331223 TGTGCAGTACCCTCCTCTCTTGG - Intergenic
1125567608 15:40689116-40689138 TGGACAGTTCCCCTCTGGCTAGG - Intergenic
1127170795 15:56299343-56299365 TGGGCAATTCCCCTCTTGCTAGG - Intronic
1128487936 15:68114907-68114929 TGGGCAGTTCTCTTCTTTCTTGG + Intronic
1129858359 15:78841156-78841178 TGGGCATGGCCCCCCTTCCTGGG + Intronic
1130046446 15:80449179-80449201 TGTGCACTTACCCCCTTTCTTGG - Intronic
1131127861 15:89870531-89870553 TTGGCAGATCCCCACTTTCCAGG - Intronic
1132424480 15:101703100-101703122 TTGGCAGTCCCAGCCTTTCTTGG - Intronic
1139626268 16:68191470-68191492 TGGCTAGTTCACCGCTTTCTGGG + Exonic
1141485027 16:84333287-84333309 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1141855424 16:86677880-86677902 TGGGGAGCTCCCACCTTGCTGGG - Intergenic
1142236019 16:88922942-88922964 TGAGCAGTTCCTTCCTCTCTGGG - Intronic
1145097541 17:20043633-20043655 TGGGCAGTTCCTTGATTTCTGGG + Intronic
1145324901 17:21814870-21814892 TGGGCGGTTCCACTCTTCCTTGG + Intergenic
1150263080 17:63812637-63812659 TGAGAAGTTCTCTCCTTTCTAGG - Intronic
1152436330 17:80278511-80278533 TGGGCAGTTCTCCTCTTACGTGG + Intronic
1152488081 17:80608704-80608726 GGGGCACTTTCCCCCCTTCTTGG + Intronic
1152528543 17:80903384-80903406 CGGGCAGTGCCCCAGTTTCTGGG - Intronic
1153074553 18:1147961-1147983 TGGGCAATTCCCCTCTGCCTAGG - Intergenic
1153714242 18:7830180-7830202 TGGGCCCTTCCCCTCTTACTGGG + Intronic
1157977618 18:52343413-52343435 TGGGCCCTTTCCCACTTTCTAGG + Intronic
1160824610 19:1073881-1073903 TGGGCAGTGCCCACCCTTCAGGG - Intronic
1160947529 19:1650686-1650708 CGGGCTGTTCCTCCCTTTCCCGG - Intronic
1162025938 19:7894170-7894192 TGGGCAGATGCCCTCCTTCTTGG + Intronic
1162479217 19:10918820-10918842 AGGGCATTTCCCTCCTTTCCAGG + Intronic
1163133872 19:15295054-15295076 TGGGCTGTTGCCCCCTTTTATGG - Intronic
1163324711 19:16595842-16595864 TGGGCAGTTCACTTCTTTCTAGG + Intronic
1163685947 19:18711686-18711708 CGGGCAGTTCCGCCCATTCCCGG + Intronic
1164906638 19:31973564-31973586 TGGGGAGTTATCCCCGTTCTGGG - Intergenic
1166763467 19:45238778-45238800 TGGGCAGCCCCGCTCTTTCTTGG - Intronic
926753373 2:16217360-16217382 TGGGCAGAGCCCACCCTTCTGGG - Intergenic
928725650 2:34171097-34171119 GGGGCATTTCCCCCTTTGCTAGG - Intergenic
928926354 2:36583896-36583918 TGGACAGATCCCGCCTTTCAGGG - Intronic
929268546 2:39946393-39946415 TGGGCATTTGCCATCTTTCTTGG + Intergenic
930947571 2:57093275-57093297 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
931439324 2:62276859-62276881 GGGGCAGATCCCTCATTTCTTGG + Intergenic
931932007 2:67148569-67148591 TGGGCAGTTCTCCTCTGGCTAGG - Intergenic
933073703 2:77895162-77895184 GGGGCTTTTCCCCCTTTTCTCGG - Intergenic
933096667 2:78191429-78191451 TGGGGACTGCCTCCCTTTCTGGG - Intergenic
933978410 2:87530044-87530066 TGGGCACTTCTCCACTTCCTTGG - Intergenic
935875759 2:107505107-107505129 TGAAGAGTTCCCCCCTTTCCTGG - Intergenic
936315423 2:111420757-111420779 TGGGCACTTCTCCACTTCCTTGG + Intergenic
936988803 2:118340339-118340361 TGAGAATTTCCTCCCTTTCTGGG + Intergenic
941672674 2:168311314-168311336 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
942728063 2:179032279-179032301 TGGCCAGTTTTCCCCTCTCTTGG + Intronic
942814397 2:180034556-180034578 TGGGCAGTTTCCCTCTGGCTAGG + Intergenic
944550289 2:200839187-200839209 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
945651559 2:212567783-212567805 GGGGCAGTGCTACCCTTTCTTGG - Intergenic
945711826 2:213306637-213306659 TGGGCAAGTCCCCTCTTGCTAGG + Intronic
946134206 2:217632238-217632260 TGGGAAGCTCCCCCCATGCTTGG - Intronic
946410341 2:219512400-219512422 GGGGCAGTTTCCCGCTTTCTTGG + Intergenic
946559065 2:220892263-220892285 TGTGCAGCTGCCCCTTTTCTGGG + Intergenic
947889920 2:233608357-233608379 TGGGAAGTTCACTCCTTACTGGG + Intergenic
1174938430 20:54897814-54897836 TGGGCAGTTCTTCCCTGGCTAGG - Intergenic
1177557028 21:22703891-22703913 TTGGCAGTGCCCCACTTTCCTGG - Intergenic
1177692715 21:24532007-24532029 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1177771208 21:25518681-25518703 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1178072325 21:28982368-28982390 TTGGTATTTCCCCCCTTTGTAGG - Exonic
1178475951 21:32937218-32937240 GGGGCGTTTCCCCCCTTGCTCGG + Intergenic
1179147744 21:38783367-38783389 TGGCCAGTTCCTCTCTCTCTGGG - Intergenic
1180316142 22:11278356-11278378 TGGGCAATTCCCTCATTCCTTGG - Intergenic
1180339197 22:11605132-11605154 TGGGCAGTTCGCTCATTCCTTGG + Intergenic
1181995812 22:26881130-26881152 TGGGCAGTTACCCTCTGTCTGGG + Intergenic
1182243431 22:28935682-28935704 TGTTCAGTTCCACCCTTTATTGG + Intronic
1182444428 22:30381854-30381876 TGGGCAGTGCCACCTGTTCTAGG + Intronic
1183326158 22:37195701-37195723 TGGGGAAATCTCCCCTTTCTTGG - Intronic
1184426445 22:44411739-44411761 TGGGCATTTCCCCCATGCCTGGG + Intergenic
953474637 3:43195001-43195023 AGGGAATTTCCCCCCATTCTGGG - Intergenic
954138308 3:48592441-48592463 TGGTCAGTTCCGGCCCTTCTAGG + Exonic
956100454 3:65762528-65762550 TGAGTAGTTCACCCTTTTCTTGG - Intronic
956137808 3:66116398-66116420 TGGGCAGTTCCTCTGTTCCTTGG + Intergenic
956222783 3:66922405-66922427 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
957149822 3:76471856-76471878 TGGGCTTTTCCCCCTTTGCTTGG - Intronic
959492078 3:107002162-107002184 GGGGCTTTTCCCCCCTTGCTTGG - Intergenic
960298173 3:115968883-115968905 TGGGCAATTCCCCTCTGGCTAGG + Intronic
960785098 3:121363438-121363460 TTGGCAGTTCCCCTCTGGCTAGG + Intronic
962078813 3:132115077-132115099 TGGGTAATTCCCCTCTATCTAGG + Intronic
963020581 3:140869350-140869372 TGGGCAATTCCCCTTTCTCTAGG + Intergenic
963410015 3:144915406-144915428 AGGGCAGTTCCTCTCTTCCTAGG - Intergenic
964151574 3:153531853-153531875 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
966451962 3:180073399-180073421 TGGGCAGTTCCCCTCTGGCTTGG - Intergenic
967025616 3:185561425-185561447 TGGGCAGGTTACCCCTTTCTGGG + Intergenic
967946585 3:194808950-194808972 TGGGCAGTTTGCCCAGTTCTAGG - Intergenic
969467166 4:7364534-7364556 TGGGCAGTCTCCTCCTTCCTTGG + Intronic
970442370 4:16092910-16092932 TGGGCACTTCCCCTCTGACTAGG - Intergenic
971148132 4:24001963-24001985 TGTGCCCTTCCCCCATTTCTTGG - Intergenic
973614323 4:52663666-52663688 TGGCCAATTTCCCCCTTTTTGGG + Intergenic
974266916 4:59597820-59597842 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
977527928 4:98166772-98166794 TGGGCAATTCCCCTCTGGCTAGG + Intergenic
977684781 4:99835601-99835623 AGCGCTGTTCCCTCCTTTCTAGG + Exonic
979812495 4:125055263-125055285 TTTGCAGTTCTCTCCTTTCTAGG - Intergenic
980760993 4:137234056-137234078 TGGCCAGTTCTCCCCTTTCAAGG + Intergenic
983508710 4:168584951-168584973 AGTAGAGTTCCCCCCTTTCTTGG + Intronic
987496666 5:18653515-18653537 TGGGCAATTCCCCTCTGTCTAGG + Intergenic
988934870 5:36071734-36071756 TGGGCAGTGTCACCATTTCTTGG - Intergenic
989628872 5:43460780-43460802 TGGGCATTTCCCCTCTGGCTTGG - Intronic
990954530 5:61330294-61330316 TGGGCACTTCCTCCATGTCTAGG - Intergenic
991094024 5:62720399-62720421 GGGCTAGTTCCTCCCTTTCTGGG + Intergenic
994226069 5:97253287-97253309 TGGGCACTTCCCCTCTGGCTAGG - Intergenic
994562699 5:101396207-101396229 TGGGCTGATTCCCTCTTTCTGGG + Intergenic
994853731 5:105090434-105090456 TTGGCAGTTCCCTTCTGTCTAGG - Intergenic
995557446 5:113344243-113344265 TGGGCAATTCCCCTCTGGCTAGG - Intronic
1000068561 5:157718510-157718532 TGAGCATTTCCTTCCTTTCTGGG + Intergenic
1002886468 6:1300211-1300233 TGGGCAGTACCTCCTTTACTGGG - Intergenic
1003861247 6:10323810-10323832 TGGGCACTTTCCCACTGTCTTGG - Intergenic
1004817496 6:19328343-19328365 TGGTCAATGCCCTCCTTTCTGGG + Intergenic
1006326273 6:33356378-33356400 TGGGCAGGTTGCCCCTTTCTGGG + Intergenic
1006993960 6:38240360-38240382 TGGGCACTTCCCTCCTCTCATGG - Intronic
1007727244 6:43923939-43923961 TGGGCTGTTCCCCTCTGTGTGGG - Intergenic
1007771234 6:44194020-44194042 TGTGCAGGTACCCACTTTCTTGG + Intergenic
1008707648 6:54182198-54182220 TGGGCAGTTCCCCTCTGTATAGG + Intronic
1010140029 6:72602962-72602984 TTGGCAGTTCCCCTCTGGCTAGG + Intergenic
1010560401 6:77341720-77341742 TGGGCACTTCCCCTCTGGCTAGG + Intergenic
1012003526 6:93684424-93684446 TGGGGAATTCCCCTCTGTCTAGG - Intergenic
1012224392 6:96688112-96688134 TGGGCAGCTCCCCTTTGTCTAGG - Intergenic
1012807189 6:103909050-103909072 TGGGCAGTTCCCCTCTGGCTAGG + Intergenic
1013567527 6:111382549-111382571 TGGGCAGTTTCCCTCTGGCTGGG - Intronic
1014275599 6:119384780-119384802 TGGGCAGTTCCCCTCTTGTTAGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1016936898 6:149454509-149454531 TGGGCGGTTCCCCAGATTCTTGG - Intronic
1017841623 6:158227075-158227097 TGGGCAACTCCCCTCCTTCTTGG - Intergenic
1017924832 6:158901706-158901728 TGGGCAGTTCCCCCCTGGCTAGG + Intronic
1021046043 7:15924567-15924589 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1024606698 7:51027885-51027907 TGGGCTTTTCCTCTCTTTCTAGG + Exonic
1025028635 7:55537835-55537857 TGGGCAGTTCCCCCTTTCATGGG - Intronic
1025206547 7:56996420-56996442 TGGGAATTCTCCCCCTTTCTGGG - Intergenic
1025665391 7:63580507-63580529 TGGGAATTCTCCCCCTTTCTGGG + Intergenic
1027685435 7:81274348-81274370 TGGGCACTTGCCCCCTGGCTAGG + Intergenic
1029549112 7:101227574-101227596 AGGGCAGCACCCCCCTTTCCTGG + Intergenic
1029559546 7:101293499-101293521 TGGGCAGTTCTACTCTTCCTTGG + Intergenic
1030110269 7:106020918-106020940 TGGGGGGTTCACCCTTTTCTTGG - Intronic
1030110663 7:106023801-106023823 TGAGGAGTTCCCACCTTTCTTGG + Intronic
1032026160 7:128444235-128444257 AGGGCACTTCCCTCCTTTCTTGG + Intergenic
1032737384 7:134704764-134704786 TGATCAGTTCACCCCTCTCTAGG - Intergenic
1032920024 7:136534678-136534700 TGGGCAGGTCCCCCTTCTGTAGG - Intergenic
1035281775 7:157783069-157783091 TGGGCTTTTCCCCCTTTGCTCGG + Intronic
1035955653 8:4076216-4076238 GGGGCTTTTCCCCCGTTTCTTGG + Intronic
1036483609 8:9159863-9159885 TGGGGATTCACCCCCTTTCTGGG + Intronic
1037766131 8:21773409-21773431 TGGCCAGTGCCTCCCTTCCTGGG + Intronic
1040470439 8:47731784-47731806 TGGGCAGTTCCCCCCTTTCTGGG - Intronic
1045727849 8:105196415-105196437 TCTGCAGTTCCCTCCTCTCTTGG + Intronic
1046456835 8:114476838-114476860 TGGACAGTTCCCCTCTTGCTAGG - Intergenic
1047841093 8:128754267-128754289 TGGGCACTTCCCCTCTGTCTAGG - Intergenic
1048454915 8:134569187-134569209 TGGGCAGTGTCACCCTTTCATGG + Intronic
1051047098 9:12888356-12888378 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1054831896 9:69634347-69634369 TGGGCAATTCCCCTCTGGCTAGG - Intronic
1055171534 9:73265254-73265276 GGGGCTCTTCCCCCCTTTCCTGG + Intergenic
1055189378 9:73498717-73498739 GGGGCTGTTCCCCCTTTGCTTGG + Intergenic
1055580070 9:77698964-77698986 TGGGCAGTTCTCCTCTGGCTAGG + Intergenic
1057638557 9:96795365-96795387 GGGGCATTTCCCCCTTTGCTTGG - Intergenic
1057683410 9:97212121-97212143 TGGGAAGTTCCCACCATGCTAGG - Intergenic
1058820787 9:108727793-108727815 TGGGCAGTTCCCCTCTTGCTAGG - Intergenic
1058862371 9:109128636-109128658 TGGGTTGTTCTCCCCTTTCTTGG + Intergenic
1062151335 9:135020672-135020694 TGGGCAGTTCTCCACCTGCTCGG + Intergenic
1203364443 Un_KI270442v1:244307-244329 TGGGCAATTCCCTCATTCCTTGG - Intergenic
1186602249 X:11050216-11050238 TGGGTAGTTCCCCTCTGGCTAGG + Intergenic
1186932735 X:14412679-14412701 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1187308540 X:18119240-18119262 TGGCCATCTCCCCTCTTTCTTGG - Intergenic
1188027516 X:25226214-25226236 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1190898943 X:54650440-54650462 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1192507587 X:71698381-71698403 TGGGCAGGTTGCCCCTTTCTGGG + Intergenic
1192519109 X:71783171-71783193 TGGGCAGGTTGCCCCTTTCTGGG - Intergenic
1192570379 X:72198920-72198942 GGGCCAGTTCACCCCTTTTTAGG - Intronic
1193509099 X:82377784-82377806 TGGTCAGTTCACACCATTCTGGG + Intergenic
1193855697 X:86599210-86599232 TGGCCAATTCCTTCCTTTCTAGG + Intronic
1194539804 X:95156446-95156468 TGGGCAGGGCCTCCCTATCTGGG + Intergenic
1195000851 X:100641910-100641932 TGGTCCCTTCCCTCCTTTCTTGG - Intergenic
1195438372 X:104872295-104872317 TGAGCAGTTTCAACCTTTCTGGG + Intronic
1195509774 X:105701578-105701600 TGGCCAGTTCCTCCCTGGCTTGG - Intronic
1195877081 X:109552741-109552763 TGGGCTGATTCCCCCTTTTTGGG + Intergenic
1196641606 X:118068877-118068899 GGAGCAGTTCCACCATTTCTTGG - Intronic
1199223060 X:145339823-145339845 TGGGCAATTCCCCTCTGACTAGG - Intergenic
1199277533 X:145964041-145964063 TGGGCAATTCCCCTCTGGCTAGG - Intergenic
1199594117 X:149493271-149493293 TGGCCAGCTCCACCCCTTCTGGG - Intronic
1201074203 Y:10174956-10174978 TGGGCAATTCCCTCATTCCTTGG + Intergenic