ID: 1040471658

View in Genome Browser
Species Human (GRCh38)
Location 8:47738997-47739019
Sequence GACGCCCGGGTCTGCGGGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040471658_1040471668 11 Left 1040471658 8:47738997-47739019 CCGACCCCGCAGACCCGGGCGTC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1040471668 8:47739031-47739053 CCCGCGCCCGCGTTTCTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1040471658_1040471672 18 Left 1040471658 8:47738997-47739019 CCGACCCCGCAGACCCGGGCGTC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1040471672 8:47739038-47739060 CCGCGTTTCTTCCAGGTCTACGG 0: 1
1: 0
2: 1
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040471658 Original CRISPR GACGCCCGGGTCTGCGGGGT CGG (reversed) Exonic
900164157 1:1238033-1238055 GAGGCCCGGGCGTGCGGGCTGGG + Intergenic
900226382 1:1535268-1535290 GACGCCCGGGCCGGCGGGACTGG - Exonic
900350901 1:2234090-2234112 AAGGCCAGGGTCTGCGGGTTTGG + Intronic
901086272 1:6613985-6614007 GCCGCCCGGGGCTGGGGGCTCGG - Exonic
902404448 1:16175148-16175170 GAAGCCTGGGCCTGAGGGGTGGG + Intergenic
902809521 1:18880235-18880257 GACGCCCGGGTCTGCAGCTCAGG - Intronic
904162282 1:28530705-28530727 GCTGCCCGGGGCTGCGGGTTGGG + Intronic
912431458 1:109630447-109630469 GACGCTGGGGTCTCCCGGGTTGG + Intronic
913963039 1:143353954-143353976 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
914057394 1:144179539-144179561 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
914121752 1:144786827-144786849 GAATCCCGGGTCAGCGGGGTGGG - Intergenic
915116411 1:153603464-153603486 GATGCCCAGTTCTGCAGGGTGGG + Intergenic
915477455 1:156161284-156161306 GACACGCGGGGCTGGGGGGTCGG + Intronic
917969110 1:180196027-180196049 GAGGGCCGGGGCTGAGGGGTAGG + Intronic
920684148 1:208096308-208096330 GAAGTCTGGGTCTGAGGGGTGGG - Intronic
1062956646 10:1544518-1544540 CACGGCAGGGTCTGCAGGGTTGG + Intronic
1073289651 10:102407198-102407220 GAGTCCCGGGGCTGCGTGGTGGG - Intronic
1073326093 10:102644561-102644583 GACCCCCGGGGCTGGGGAGTCGG + Exonic
1075527476 10:123198765-123198787 GGCGCCAGGGACTGTGGGGTTGG + Intergenic
1075655328 10:124157231-124157253 GCCGCCTGGGTCTCCTGGGTTGG - Intergenic
1076839492 10:133039077-133039099 GACCCCTGGGGCTGTGGGGTTGG - Intergenic
1076850025 10:133088147-133088169 GACGCGCGGGTCTGGGCGGCGGG + Intronic
1078464193 11:11538460-11538482 GAGGCCTGGGCCTGCAGGGTGGG + Intronic
1084161455 11:67352699-67352721 GAAGCGGGGGTCTCCGGGGTGGG + Exonic
1085019893 11:73199653-73199675 GTCGCCAGGGGCTGAGGGGTAGG - Intergenic
1089602672 11:119625027-119625049 GAGGCCCTGGTGTGGGGGGTTGG + Intronic
1091301976 11:134513789-134513811 GCCGCGCGGGTGTGCGGGGACGG + Intergenic
1091393424 12:139372-139394 GACGCCCAGGACTCCGGGCTGGG - Intronic
1091743564 12:2976783-2976805 GCCGCCCGGGCCTGGGGGCTGGG + Intronic
1098465751 12:70784051-70784073 GATGCCTGGGTCTGCGGTTTGGG + Intronic
1098550330 12:71755009-71755031 AGCGCCCGGGTCGGCGGGGCCGG + Exonic
1101350908 12:103929536-103929558 GCCGCCCGGTTCTGGGGGGTCGG - Intergenic
1103918585 12:124388260-124388282 GCCGGCCAGGGCTGCGGGGTAGG + Intronic
1109426105 13:62167922-62167944 GAGGCCCAGGTCTGCAGGTTAGG - Intergenic
1110728566 13:78853518-78853540 GGTGCCTGGGTCTGCGGGTTGGG - Intergenic
1113481469 13:110625117-110625139 GACGCCTGTGTCTGGCGGGTGGG + Intronic
1113656222 13:112069002-112069024 GTCGCCAGGGTCTCCGGGGAAGG - Exonic
1113695588 13:112343232-112343254 CAGGCCGGGGTCTGCGGGGGAGG + Intergenic
1115398181 14:32933095-32933117 GACGCCCGGGTCTGCGGCAAGGG + Intergenic
1119484893 14:74980841-74980863 GCCGCCAGGGTCTGCAGAGTAGG - Intergenic
1122127446 14:99586909-99586931 GCCGCCCGTGGCTGCGGGCTTGG - Intronic
1123431299 15:20219304-20219326 GAGGCCCGGGTCTGCCGGAGAGG + Intergenic
1125882964 15:43209399-43209421 GTGGCCTGGGTCTGCGGGGTGGG + Exonic
1132144914 15:99424019-99424041 GAGGCCAGGGGCTGCAGGGTGGG - Intergenic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132741350 16:1414790-1414812 GGGGCCGGGGTCTGCGGGCTGGG - Intergenic
1133029637 16:3004334-3004356 GACGGCGGGGGCAGCGGGGTGGG - Intergenic
1133464638 16:6018542-6018564 GAGGCCCAGCTGTGCGGGGTGGG + Intergenic
1136382021 16:29900268-29900290 GGCGCCCGGGACTGCGGGCAAGG - Intergenic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1138471957 16:57245133-57245155 GAGGCCCGGACCTGCGGCGTCGG + Exonic
1142892176 17:2950998-2951020 GAAGCCCAGGTCTGGGGAGTGGG - Intronic
1142990053 17:3724276-3724298 GACGCCTGGGGCTGCGAGCTCGG + Exonic
1145979332 17:29002552-29002574 GAAGCCCGGGGCTGGTGGGTGGG + Intronic
1146009088 17:29179965-29179987 GTGGCCCGGAGCTGCGGGGTGGG - Intronic
1146064279 17:29622661-29622683 GACGGCCGGGTGTGGGGGGCTGG + Intronic
1147168695 17:38606040-38606062 GCCGCCCGGGGCGGCGGGGGCGG + Intergenic
1148081871 17:44971283-44971305 GATGCCAGGGGCTGCTGGGTAGG - Intergenic
1148178547 17:45586985-45587007 GCCACCCAGGTCTGCTGGGTTGG - Intergenic
1148617786 17:49013779-49013801 CGCGCCAGGGGCTGCGGGGTGGG - Intronic
1151337807 17:73450397-73450419 CATGTCCCGGTCTGCGGGGTGGG - Intronic
1151882390 17:76903379-76903401 GAGGCCTGGGGCTGAGGGGTGGG + Intronic
1152621416 17:81366771-81366793 GGCGCCCGGGGAGGCGGGGTTGG + Intergenic
1154367628 18:13726136-13726158 GCCGCCGGGGTCTGTGGGGTCGG + Intronic
1155218336 18:23662644-23662666 GGCGGCCGGGCCCGCGGGGTCGG - Intronic
1158332684 18:56380236-56380258 GACTCCCAGGTCTCCTGGGTGGG + Intergenic
1160515874 18:79478898-79478920 GAGGCCTGGGTCTGCGGGGACGG + Intronic
1160773427 19:843881-843903 GGCGCTGGGGTCTGCGGGGGTGG - Exonic
1161850485 19:6735694-6735716 AAATCCCGGGTCTGGGGGGTGGG + Exonic
1161939695 19:7394887-7394909 GAGGGGCGGGTCAGCGGGGTTGG - Intronic
1162651567 19:12092566-12092588 GACTCCGGGGTCTGTGGGGCTGG + Intronic
1162691941 19:12440652-12440674 GAGACCCGGGGCTGCGGGCTCGG + Intronic
1162957505 19:14107441-14107463 GACGCCCGTCTCACCGGGGTGGG + Intronic
1163009946 19:14418904-14418926 GACGCCGGGGTCTGGGGCCTGGG - Intronic
1163577241 19:18118043-18118065 GGCGCACGGGGCTGCGGGGATGG - Intronic
1165326148 19:35115611-35115633 GACGCCTGGGTCTACAGAGTGGG - Intergenic
1165336326 19:35172569-35172591 GAGGCCTGGGTCTGTGGTGTTGG + Intergenic
1165408633 19:35644968-35644990 GACGCCTGGGTCTCCGAGGTGGG - Intergenic
1166078006 19:40425360-40425382 GACTCCCCGGACTGCGGGGAAGG - Intronic
1166676315 19:44743170-44743192 GAGGCCCTGGTCTGCTGGATAGG + Intergenic
1166688559 19:44809855-44809877 GAGGCCGGGGGCTGGGGGGTGGG + Intronic
1166762567 19:45234318-45234340 GGCGCCCAGGCCGGCGGGGTAGG + Intronic
1166765729 19:45251446-45251468 AACGCCCGGGTCCGCGCGGCGGG - Exonic
1166790540 19:45396249-45396271 GACGTCCAGGCCTGCGGGGCGGG + Exonic
1167414455 19:49362696-49362718 GACTCCTGGGTCTGGGGGCTGGG + Intronic
1167489205 19:49782121-49782143 GACTCCTGGGTCTGCGGGGGAGG + Intronic
1167521528 19:49958746-49958768 GACCCCGGGGTCTGAGGGCTGGG + Exonic
1167523849 19:49971976-49971998 GACCCCAGGGTCTGAGGGCTGGG - Intergenic
1167756217 19:51415284-51415306 GACCCCGGGGTCTGAGGGCTGGG + Exonic
927506924 2:23620826-23620848 TACACCCGGCTCTGCGGGCTTGG - Intronic
933728114 2:85437832-85437854 GAGGCCCGGGGGTGCGGAGTGGG - Intergenic
934278036 2:91589226-91589248 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
936154856 2:110040924-110040946 GATGCCGGGCTCTGCGTGGTGGG - Intergenic
936189826 2:110330490-110330512 GATGCCGGGCTCTGCGTGGTGGG + Intergenic
937993012 2:127674720-127674742 GACGCCCAGGGCTGCGGGAGGGG - Intronic
946422210 2:219571298-219571320 GAGGCCCGGGGCGGCGGGGTCGG + Intronic
948575609 2:238947477-238947499 GAGGCCCGGGTCTGCAGCTTTGG + Intergenic
1172892767 20:38278558-38278580 GAGTCTCGGGTCTGCGGAGTGGG + Intronic
1173503578 20:43570446-43570468 GACACCCGGGACTGCTGTGTGGG + Intronic
1179492871 21:41752628-41752650 GCCGCCGGGGTTTGCAGGGTCGG - Intronic
1179674917 21:42974766-42974788 GCCGCCCGGGTCTGGAGGGCCGG + Intronic
1180594106 22:16962484-16962506 GGAGCCCGGGTCTGAGGGGCAGG + Exonic
1184645656 22:45893299-45893321 GAGGCCAGGGTCTGAGAGGTAGG - Intergenic
1185402930 22:50627837-50627859 GGCGCCTGGGTCTGCGGTATCGG - Exonic
950482343 3:13252204-13252226 GACGCCAGGGGCTGAGGGGAGGG - Intergenic
950643014 3:14360513-14360535 GACCCCAGGGCCTGGGGGGTGGG - Intergenic
955060422 3:55488117-55488139 GGCGCCCGGGTCCGAGGGGCGGG + Intronic
956420209 3:69079947-69079969 GGCCCCCGGGGCTGCGGGGCGGG + Intronic
956468691 3:69542764-69542786 GCCGCACGGGGCTGCGGGCTGGG + Intergenic
968600108 4:1504631-1504653 GAAGCCCTGGTCTGCGAGGAGGG - Intergenic
968894060 4:3388578-3388600 GAGGCCCAGGGCTGGGGGGTGGG - Intronic
969172966 4:5378811-5378833 GAAGCCCGAGTCTTCGGGATGGG - Intronic
970194063 4:13539274-13539296 GGCGCCCGGGTCCGCAGGGTAGG + Intergenic
973246742 4:48017373-48017395 GGCGCCCGGGGCCGCGGGGGTGG + Intronic
988547910 5:32174710-32174732 GACTCCGGGGTCTGCAGGATCGG + Intergenic
991614975 5:68486779-68486801 GTTGCCAGGGACTGCGGGGTGGG - Intergenic
999784103 5:154875441-154875463 GGCGCCAGGCTCTGCAGGGTGGG + Exonic
1001845580 5:174918086-174918108 GACGCCAGGGTGTGTGGGGTGGG + Intergenic
1002718785 5:181245809-181245831 GACGCCCAGGTGTGCAGGGAAGG + Intronic
1005810513 6:29511894-29511916 GACTCCCAGGTCTGCAGGGCTGG + Intergenic
1013944229 6:115703661-115703683 GATGCCTGGGTCTTCAGGGTTGG + Intergenic
1020002167 7:4762243-4762265 GTCACCCGGGTGTGCGAGGTGGG + Exonic
1029693452 7:102197774-102197796 CACGCCCTCTTCTGCGGGGTGGG - Intronic
1031788047 7:126059279-126059301 GACTCACAGGTCTGCAGGGTTGG - Intergenic
1037672888 8:21030211-21030233 GGAGCTGGGGTCTGCGGGGTAGG - Intergenic
1039066965 8:33617422-33617444 CATGCCTGGGTCTGTGGGGTTGG + Intergenic
1039864749 8:41490821-41490843 GACACCCCGCGCTGCGGGGTCGG - Exonic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1042126549 8:65543220-65543242 GATGCCAGGGTCTGCAGGGAGGG + Intergenic
1051170635 9:14315527-14315549 CGCGCCCGGGGCTGCGGGGCGGG + Intronic
1053436086 9:38075480-38075502 TAAGCCCGGGTCGGCGGGGCCGG - Intergenic
1053752700 9:41273206-41273228 CATGCCCGGGTCTGCGAGGCTGG + Intergenic
1054258229 9:62837558-62837580 CAGGCCCGGGTCTGCGAGGCTGG + Intergenic
1058070819 9:100598955-100598977 GGCGCCGAGGTCTGCGGGGCGGG + Intergenic
1060938068 9:127527348-127527370 GAGGCCCAGGTCTGGGGGGGTGG + Intronic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic
1061913029 9:133734917-133734939 GACCCCAGGTCCTGCGGGGTGGG + Intronic
1202800547 9_KI270719v1_random:170818-170840 CACGCCCAGGTCTGCGAGGCTGG - Intergenic
1192265460 X:69534305-69534327 GACGCCCAGGCCTGGGGGATAGG + Intergenic
1199036232 X:143053722-143053744 GAAGCCTGGGTCTGGGTGGTGGG + Intergenic
1202367937 Y:24179609-24179631 GACGCCAGCGTGTGTGGGGTGGG - Intergenic
1202502846 Y:25490508-25490530 GACGCCAGCGTGTGTGGGGTGGG + Intergenic