ID: 1040482921

View in Genome Browser
Species Human (GRCh38)
Location 8:47842451-47842473
Sequence GCTCTCCTGAGGCTCTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040482921_1040482927 17 Left 1040482921 8:47842451-47842473 CCTATACAGAGCCTCAGGAGAGC 0: 1
1: 0
2: 2
3: 17
4: 198
Right 1040482927 8:47842491-47842513 CAGCTGAGAACACCCAGAAAGGG No data
1040482921_1040482926 16 Left 1040482921 8:47842451-47842473 CCTATACAGAGCCTCAGGAGAGC 0: 1
1: 0
2: 2
3: 17
4: 198
Right 1040482926 8:47842490-47842512 CCAGCTGAGAACACCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040482921 Original CRISPR GCTCTCCTGAGGCTCTGTAT AGG (reversed) Intronic
907358547 1:53896066-53896088 CCTCTCCTGAGGCTCTCCACTGG - Intronic
909185312 1:72479771-72479793 CCTCCCCTGAGGCTCTGCAGGGG + Intergenic
909850302 1:80453684-80453706 GCTTTCCTAAGACTTTGTATTGG + Intergenic
910203227 1:84721842-84721864 GATCTCCTGAGGCTGTGTCATGG - Intergenic
911317212 1:96369912-96369934 GACCTCCTGAGGCTGTGTAACGG - Intergenic
912346314 1:108966325-108966347 GATCTCCTGAGGCTATGTCATGG + Intergenic
914254634 1:145951533-145951555 GACCTCCTGAGGCTCTGTCATGG + Intronic
914420963 1:147528026-147528048 GCTCCCCTGACGCTTTGAATAGG + Intergenic
915348849 1:155212282-155212304 GCTTTCCTGAGCCTGTGTGTGGG - Intronic
915352041 1:155232908-155232930 GCTCTCCTGAGTCTCTGTGTGGG - Intergenic
916947812 1:169746482-169746504 GCTCTCTAGAGGCTCTGGAGAGG + Intronic
917119397 1:171632490-171632512 GACCTCCTGAGGCTCTGTCACGG + Intergenic
919168959 1:193929877-193929899 GATCTCCTGAGGCTGTGTCATGG + Intergenic
919747824 1:201019732-201019754 GCCCACATGAGGCCCTGTATGGG + Intronic
920253117 1:204635735-204635757 GCTCTGCTGAGCCTCTTTCTTGG + Intronic
920749247 1:208658506-208658528 GGTCTCCTGAAGCTCTATCTAGG - Intergenic
922153536 1:223024165-223024187 GCCCTCCTGAGGCTGTGTCATGG - Intergenic
923066350 1:230520810-230520832 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1063301508 10:4853517-4853539 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1063539510 10:6918138-6918160 GCCCTCCTGAGGCTGTGTCATGG - Intergenic
1063915415 10:10877274-10877296 GATCTCCTGAGGCTGTGTCACGG - Intergenic
1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG + Intronic
1066332311 10:34438039-34438061 GCTCTCCAGAGGCTTTGTAGAGG - Intronic
1066336723 10:34485381-34485403 GATCTCCTGAGGCTGTGTTGGGG - Intronic
1068885402 10:62092243-62092265 GCTCTCCTGGGGCCCTGTGGTGG - Exonic
1069839083 10:71327945-71327967 GCTCTCCTGCAGGCCTGTATTGG + Intronic
1071198001 10:83184068-83184090 GCCCATCTCAGGCTCTGTATGGG + Intergenic
1072097582 10:92197503-92197525 GCTTTCCTGTTTCTCTGTATTGG - Intronic
1072216585 10:93292338-93292360 GAACTCCTGAGGCTGTGTATTGG - Intergenic
1074365409 10:112853930-112853952 CCTCCCCTGTGACTCTGTATTGG + Intergenic
1075693777 10:124418834-124418856 GCTGTCCTGGGGCTCTGGTTCGG - Intronic
1075732234 10:124643522-124643544 GCCCTCCCGGGGCTCTGTTTGGG - Intronic
1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG + Intergenic
1076477247 10:130761404-130761426 GCTCTCCTCTGGCCCTGTCTGGG + Intergenic
1077069690 11:662977-662999 GCTGTCCTGATGCTCTGAAAGGG + Intronic
1077559146 11:3246391-3246413 GATCTCCTGAGGCTGTGTCGTGG - Intergenic
1077888559 11:6403313-6403335 GCTCACCTGAGGCTCTGAGCTGG + Exonic
1081187709 11:40065090-40065112 GGCCTCCTGAAACTCTGTATGGG + Intergenic
1082192915 11:49268904-49268926 GAGCTCCTGAGGCTCTGTCAGGG - Intergenic
1082996998 11:59262752-59262774 GCTCTCTTGAGGCCCTGTCTGGG - Intergenic
1083826311 11:65205886-65205908 GCTCTCCTGAGGGTCAGCACAGG + Intronic
1084181440 11:67448530-67448552 GCTGGCCTGTGGCTCAGTATTGG + Intergenic
1084495424 11:69500599-69500621 GCACTGCTCAGGCTCTGTGTGGG - Intergenic
1084590431 11:70086869-70086891 CCTCTGCTCAGGCTCTGTTTGGG + Intronic
1086673218 11:89572167-89572189 GACCTCCTGAGGCTCTGTCAGGG + Intergenic
1088653776 11:111979709-111979731 TCTCTCCTCAGCCTCTGTACTGG - Intronic
1089879800 11:121762789-121762811 GCTTCCCTGAGGCTCTGGCTTGG - Intergenic
1100394292 12:94171263-94171285 GCTCTCCTCAGGATCTGTATGGG + Intronic
1101026575 12:100613241-100613263 ACTCTCCTGAAGGTCAGTATAGG + Intronic
1101609497 12:106277801-106277823 GATCTCCTGAGGCTGTGTCATGG + Intronic
1104789675 12:131473632-131473654 GCTGTCCTGAGGCTATATCTGGG - Intergenic
1106947923 13:34849257-34849279 GCTCTGTTGAGGTGCTGTATTGG - Intergenic
1107443475 13:40449099-40449121 GCTTTCCTGAGGCTCTCTTGGGG - Intergenic
1108847508 13:54695181-54695203 GATCTCCTGAGGCTGTGTCATGG + Intergenic
1109967600 13:69721395-69721417 GGTCTCCCGAGGCTGTGTAATGG + Intronic
1111624908 13:90772290-90772312 GATCTCCTGAGGCTGTGTCATGG + Intergenic
1112672453 13:101655907-101655929 GGTCTCCTGAGGCTGTGTCATGG - Intronic
1113776636 13:112951156-112951178 GCTCTCCTGAGGGTGTGCAGTGG - Intronic
1116994192 14:51305226-51305248 GGACTCCTGAGGCTGTGTCTGGG + Intergenic
1117188038 14:53261687-53261709 GCCCTCCTGAGGCTGTGTCATGG - Intergenic
1118631966 14:67713704-67713726 GACCTCCTGAGGCTGTGTCTTGG - Intronic
1118776994 14:68979367-68979389 GCCCTCCCGAGGCTCTCCATTGG + Intronic
1119113617 14:71997995-71998017 GCCCTCCTGAGGCTGTGTCATGG - Intronic
1120970644 14:90204332-90204354 GCCCTCCTGAGGCTGTGTCATGG + Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1123398535 15:19961286-19961308 GTTCTCCTGGGTCTCTGTCTGGG + Intergenic
1123943440 15:25227645-25227667 TCTCTCCTGAGGCCCTGCAGGGG + Intergenic
1125478358 15:40062945-40062967 GCTCTCCTGAAGGTCTCTCTTGG + Intergenic
1125857588 15:42965309-42965331 GCCTTCCTGTGGCTTTGTATGGG - Intronic
1126296874 15:47149063-47149085 ATTCTCTTGAGGCTCTGTATAGG - Intergenic
1127633090 15:60844222-60844244 GCTGTCCTGAGGCTCTCTCAAGG + Intronic
1129466624 15:75727844-75727866 GCTCTCCCGAGTCTCTGCCTGGG - Intergenic
1129478412 15:75803481-75803503 GCCCTCCTGGGGCTCTGCCTTGG - Intergenic
1129735448 15:77958967-77958989 GCCCTCCTGGGGCTCTGCCTTGG + Intergenic
1129836500 15:78710801-78710823 GCCCTCCTGGGGCTCTGCCTTGG - Intronic
1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG + Intronic
1130263683 15:82379670-82379692 GCTCTCGGGAGGCTTTGTTTGGG + Intergenic
1130277608 15:82489975-82489997 GCTCTCGGGAGGCTTTGTTTGGG - Intergenic
1130469933 15:84217164-84217186 GCTCTCGGGAGGCTTTGTTTGGG - Intergenic
1130477421 15:84331727-84331749 GCTCTCGGGAGGCTTTGTTTGGG - Intergenic
1130494344 15:84456403-84456425 GCTCTCGGGAGGCTTTGTTTGGG + Intergenic
1130592222 15:85221788-85221810 GCTCTCGGGAGGCTTTGTTTGGG - Intergenic
1130896294 15:88172903-88172925 CCTCTTCTGAGGCCCTGTAAAGG - Intronic
1131623182 15:94089219-94089241 GCTCAGCTGAGGCTGTGTAGAGG - Intergenic
1131720876 15:95166914-95166936 GATCTCTTGAGGCTAGGTATTGG - Intergenic
1133682061 16:8129048-8129070 GATCTCCTGAGCCTGTGTCTTGG - Intergenic
1134182540 16:12059333-12059355 GCCCTCCTGAGGCTCTGACCTGG - Intronic
1141192754 16:81836302-81836324 GATCTCCTGGTGCCCTGTATTGG + Intronic
1141850341 16:86640770-86640792 TCTCTCCTGAGCCCCTGTCTTGG + Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1147742728 17:42678064-42678086 AATATCCTGCGGCTCTGTATAGG + Intergenic
1147869021 17:43574259-43574281 GTTGGCCTGAGGCTCTGTTTGGG + Intronic
1149731946 17:58954575-58954597 GCTCTCAAAAGGTTCTGTATTGG + Intronic
1150161681 17:62903238-62903260 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1150479433 17:65497952-65497974 TCTCTCCTCAGGCTCTGCATTGG + Intergenic
1152207840 17:78984669-78984691 GCCCTCCTGAGGCTGTGTCAGGG + Intergenic
1157017735 18:43738278-43738300 TATCTCCTGATGCTCTGTTTTGG + Intergenic
1157667533 18:49500210-49500232 GCTCTCCTGAGGACTTCTATTGG + Intergenic
1160091641 18:75832821-75832843 TGTCTCCTGAGGCCCTGGATGGG + Intergenic
1160402869 18:78623621-78623643 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1160953270 19:1677722-1677744 GTACTTCTGAGGCTCTGAATGGG + Intergenic
1162520875 19:11178641-11178663 GCTCTTCTCAGGCTGTGTAAGGG + Exonic
1164727809 19:30478410-30478432 GAGCTCCTCAGGCTCTGAATGGG - Intronic
1164802881 19:31092254-31092276 GCCTTCCTGAGGCTCAGTTTTGG + Intergenic
1166103951 19:40588544-40588566 GCTGTCCTGAGGCTCTGGACGGG + Intronic
1166810981 19:45514625-45514647 GCCCTACTGAGGCTCTGGACTGG - Intronic
927464566 2:23327524-23327546 TCTCTACGGAGGCTGTGTATGGG - Intergenic
931838432 2:66124721-66124743 GCTCCCCTGAGCCTCTTTATAGG - Intergenic
932297941 2:70642347-70642369 GGTCTCCTGAGGTACTGTGTGGG - Intronic
932852423 2:75200033-75200055 ACTTTCCTGAGGCTGTGTTTAGG + Intergenic
934845699 2:97660194-97660216 GCTCTCCTGAGGGTCTGATCAGG + Intronic
937349961 2:121154547-121154569 GCTCTCCTGGGACTCTGTCTAGG - Intergenic
941937387 2:170995447-170995469 TCTCTCCTTAGGCTCTTAATAGG - Intronic
942726038 2:179009059-179009081 GCTCTCCTAATGCTGTGCATGGG + Intronic
945102901 2:206279000-206279022 GCTCTCTTGAGCCTATGTGTTGG + Intronic
948244966 2:236473309-236473331 CCTCTCCCGAGACTCTGTTTGGG - Intronic
1169587090 20:7097107-7097129 GCTATCCAGAGGTTCTGTCTGGG - Intergenic
1171339487 20:24416115-24416137 TCTCGCCTGAGTCTCCGTATCGG - Intergenic
1172794412 20:37527306-37527328 GGTCTCCTGAGGCTCCGCTTCGG - Intronic
1173005038 20:39133759-39133781 GCTGCTCTGGGGCTCTGTATTGG - Intergenic
1173496618 20:43523633-43523655 GCTCTCCTGAAGGTCTGTACTGG + Intronic
1174143488 20:48433768-48433790 GCTCTCCTGGGGCTTTGTCATGG + Intergenic
1174162637 20:48562621-48562643 TCACTCCTGAGGCCCTGAATGGG - Intergenic
1176052175 20:63125605-63125627 GCTCCCCTGAGGCCTTGTCTCGG + Intergenic
1176144992 20:63561595-63561617 GCACACCTGAGGCTCTGGTTCGG + Exonic
1176745227 21:10646028-10646050 GTTCTCCTGGGTCTCTGTCTGGG + Intergenic
1176908073 21:14528498-14528520 GCTCCCCTGAGGATCTGTTTTGG + Intronic
1177756124 21:25350239-25350261 GCCCTCCTGTGGTTCTCTATGGG - Intergenic
1179564084 21:42235451-42235473 GGTCTCCTGAGGCTGTGTCACGG - Intronic
1180036562 21:45253319-45253341 GCTCTCCTGGGGCTATGTCTTGG + Intergenic
1181929056 22:26384682-26384704 CCACTCCTGAGGCACTGGATGGG + Intergenic
1182105601 22:27686805-27686827 ACTCCCCTGTGGCTCTGCATTGG - Intergenic
1182695950 22:32199454-32199476 TCTCTCCTGAGCCTCTGCAGTGG - Intronic
1183220939 22:36512592-36512614 GCTCTCCTGCAGCACTGTAATGG - Exonic
1185175885 22:49326320-49326342 GCTCACCTGAGACCCTGGATGGG + Intergenic
952492224 3:33883754-33883776 GCTGTGATGAGGCTCTGTAGCGG + Intergenic
953381864 3:42478138-42478160 CCCCTGCTGAGGCTCTGTCTGGG - Intergenic
954067050 3:48115170-48115192 GATCTCCTGGGGCTCTGTCATGG + Intergenic
954178543 3:48863431-48863453 GCCCTCCTCTGGCTCTGCATAGG - Intronic
958491983 3:94787471-94787493 GCTCTCCTGAAGTACTGCATAGG + Intergenic
959162785 3:102740501-102740523 GCTCTCCTGTGACTTTGTAATGG + Intergenic
962864720 3:139438360-139438382 GCTCCCCTGAGGCTTTATAATGG - Intergenic
963311523 3:143715213-143715235 CCTCTCTTTAGGGTCTGTATGGG + Intronic
965883247 3:173412834-173412856 GATCTCCTTTGGCTCTGTAATGG + Intronic
967973055 3:195013215-195013237 GCTGTCCTGAGGCACTGCATGGG - Intergenic
972267106 4:37472025-37472047 GCTCTCCAGTGGCTCCGTCTGGG + Intronic
975484955 4:74925747-74925769 GATCTCCTGAGGCTGTGTCATGG - Intergenic
976815531 4:89144252-89144274 TCTCTCCTGATGCTCTGTGAAGG + Intergenic
977277778 4:94999685-94999707 TCTCTCCTGAAGCTCTCTCTGGG - Intronic
978410105 4:108416707-108416729 GCTCTCCAGAGACCCTGTCTTGG - Intergenic
978423082 4:108554633-108554655 GACCTCCTGAGGCTGTGTCTCGG + Intergenic
979080257 4:116329808-116329830 GCTCCCCTGAGCCTTTTTATAGG - Intergenic
985027221 4:185749898-185749920 GCTCTCCTGCTGCTCTGTCATGG + Intronic
987486705 5:18534958-18534980 GATCTCCTGAGGCTATGTCATGG + Intergenic
988523312 5:31965208-31965230 GCTCTCCTCCGTCTCTGTATGGG - Intronic
989319289 5:40116573-40116595 GATCTCCTGAGGCTGTGTTATGG - Intergenic
989425517 5:41291169-41291191 ACCCAGCTGAGGCTCTGTATGGG - Intergenic
992537760 5:77728257-77728279 GCTCTTCTGAGGCCCTTTCTGGG - Intronic
995391655 5:111646578-111646600 GCTTTCCTGAGGTTGTGTTTTGG + Intergenic
995477393 5:112562010-112562032 GCTCTCCTGAGACTGTGTCATGG + Intergenic
1000212196 5:159118034-159118056 GCTCTGCTCAGGGGCTGTATGGG + Intergenic
1000646693 5:163768190-163768212 GCTTTTCTGTGGCTCTGTCTAGG + Intergenic
1001954701 5:175841170-175841192 GCTCACCAGAGGGTATGTATGGG - Intronic
1002939687 6:1705244-1705266 GCTCTCCGGAGGCTTTGGAAAGG - Intronic
1005824147 6:29622421-29622443 CCCCTGCTGAGGCTCTGTGTGGG + Intronic
1007735739 6:43981284-43981306 GCTATCCTGGGGTTCTCTATAGG - Intergenic
1011531163 6:88322562-88322584 GCTTTGCTGAGCCTCTGTGTAGG - Intergenic
1013253378 6:108358066-108358088 GCTCTCCTGCCGCTCTGAAGAGG + Intronic
1013410140 6:109876555-109876577 GATTTCCTGAGGCTCTGTCACGG - Intergenic
1013419132 6:109950333-109950355 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1016521558 6:144952229-144952251 GATCTCCTGAGGCTGTGTCCTGG + Intergenic
1017779758 6:157706715-157706737 GCCCTCCTGAGGCTGTGTCACGG - Intronic
1019064808 6:169288062-169288084 TCCCTCCTGAGGCTCCGTAGGGG + Intergenic
1019622788 7:2000777-2000799 GCTGTCCTGAGCCTCTGGAATGG - Intronic
1020430455 7:8112249-8112271 GCTCTACAGAGGCTCTGGAAGGG + Intergenic
1020812115 7:12861127-12861149 GGTCACCTGTGGCTCTGTCTTGG + Intergenic
1021318506 7:19182070-19182092 GCTCTCCTCAGACTCTGGAATGG - Intergenic
1022616548 7:31936842-31936864 GACCTCCTGAGGCTCTGTCGTGG - Intronic
1023285922 7:38619731-38619753 GCTCTCCTGGGGATGTATATTGG - Intronic
1024716435 7:52085078-52085100 GCTCTCCTGAGGCTGTGTCATGG - Intergenic
1026291596 7:69011333-69011355 GAGCTCCTGAGGCTCTGTCATGG - Intergenic
1029042539 7:97592774-97592796 GCTCTTCTGAGGCTATTTCTAGG + Intergenic
1029687342 7:102157818-102157840 TCTCTCATGATGCTCTGTGTTGG + Intronic
1030082957 7:105793180-105793202 GCTGTCCTGAGGCTCTGAAGGGG + Intronic
1031176132 7:118353614-118353636 GCCCTCCTGAGGCTGTGTCATGG - Intergenic
1035297072 7:157873316-157873338 CCTCGTCTGAGGCTCTGGATGGG + Intronic
1036677020 8:10842631-10842653 CTTCTCCTGAGGCTCTGGAGAGG + Intergenic
1037362555 8:18089183-18089205 GTTCTCCTGAGGGTCTTTTTTGG + Intergenic
1039687706 8:39823636-39823658 GATCTCCTGTGCCTCTGTCTTGG + Intronic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1040621066 8:49093270-49093292 GACCTCCTGAGGCTGTGTCTTGG + Intergenic
1042933527 8:74035994-74036016 GATCTCCTGAGGCTGTGTCATGG + Intergenic
1045904010 8:107321093-107321115 GCTCTACTGAGGCTCACTAGAGG + Intronic
1047048475 8:121081701-121081723 ACTCTCCTGAGGCATTGTTTAGG + Intergenic
1049339692 8:142105505-142105527 GCTGGCGTGTGGCTCTGTATTGG - Intergenic
1049362844 8:142220465-142220487 GGTCTCCTGTGGCTCTCTAGAGG - Intronic
1049429408 8:142552376-142552398 GCCCTCCTGAGGCTGTGTCATGG - Intergenic
1049594411 8:143476863-143476885 GGTCTCCTGCGGCTGTGGATGGG - Intronic
1050989914 9:12137560-12137582 GCTCTCCTGAGGCTATGCCACGG + Intergenic
1052412201 9:28136337-28136359 GCTCTACTCAGGCTCTATACAGG + Intronic
1055462817 9:76535179-76535201 GATCTCCTGAGGCTGTGTCATGG + Intergenic
1056058234 9:82851985-82852007 GACCTCCTGAGGCTGTGTCTTGG + Intergenic
1057910236 9:99014687-99014709 GATCTCCTGAGGCTGTGTCACGG - Intronic
1058108592 9:101004056-101004078 GATCTCCTTTGGCTCTTTATTGG - Intergenic
1060395353 9:123312715-123312737 GCTCTGCTGAGTCATTGTATGGG + Intergenic
1185590601 X:1274243-1274265 GATTTCCTGAGGCTCTGTCATGG - Intronic
1185743009 X:2549022-2549044 ACTCTCTTGAGGGTCTGGATCGG - Intergenic
1185769530 X:2755015-2755037 GCTGTCCTGTAGCTCTGTCTGGG + Intronic
1187205400 X:17176727-17176749 GCTCTGCTGAAGGTCTCTATGGG + Intergenic
1187379418 X:18786904-18786926 ACTCTCCCCAGGGTCTGTATTGG - Intronic
1192675802 X:73194857-73194879 GATCTCCTGAGGCTGTGTCATGG - Intergenic
1193284984 X:79701747-79701769 GGTCTCCTGATTCTCTGTCTAGG + Intergenic
1194159398 X:90432336-90432358 GACCTCCTGAGGCTGTGTAATGG - Intergenic
1194247175 X:91529803-91529825 GACCTCCTGAGGCTGTGTAATGG - Intergenic
1197173000 X:123455229-123455251 GCTGTCATGAGACTGTGTATTGG - Intronic
1200505698 Y:4009306-4009328 GACCTCCTGAGGCTGTGTAATGG - Intergenic
1200899618 Y:8416395-8416417 GCTCTGCTGAGACTCCATATAGG - Intergenic
1201300977 Y:12504614-12504636 GCTGTCCTGTAGCTCTGTCTGGG - Intergenic