ID: 1040483587

View in Genome Browser
Species Human (GRCh38)
Location 8:47849727-47849749
Sequence CAGAGCACAGTGATGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040483587_1040483589 -8 Left 1040483587 8:47849727-47849749 CCAGTCCACATCACTGTGCTCTG 0: 1
1: 0
2: 3
3: 66
4: 257
Right 1040483589 8:47849742-47849764 GTGCTCTGTGCTGAGCACCCAGG No data
1040483587_1040483590 -1 Left 1040483587 8:47849727-47849749 CCAGTCCACATCACTGTGCTCTG 0: 1
1: 0
2: 3
3: 66
4: 257
Right 1040483590 8:47849749-47849771 GTGCTGAGCACCCAGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040483587 Original CRISPR CAGAGCACAGTGATGTGGAC TGG (reversed) Intronic
900289589 1:1918252-1918274 CAGGTCACAGTGCTGTGTACAGG + Exonic
900600232 1:3499724-3499746 CAGCGGGCAGTGATGTGGAGGGG + Intronic
900809038 1:4787296-4787318 CAGAGCAGAGTGATGGGGCTGGG + Exonic
900926008 1:5706430-5706452 GGGAGCACAGTGTTGGGGACAGG - Intergenic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
903207987 1:21797231-21797253 CTGAGCACAGTGACCTGAACAGG - Intergenic
904478386 1:30778819-30778841 CAGAGCCCAGAGAGGTGGAGAGG + Intergenic
905565306 1:38959786-38959808 TAGAGCACTGGCATGTGGACTGG - Intergenic
907243644 1:53093920-53093942 CAGGGCACAGTGAGATGGGCAGG - Intronic
907484360 1:54766846-54766868 TAGAGCATAGTGGTGTGGAGAGG + Intergenic
908458511 1:64327235-64327257 CAGAGCCCAGCCATGTGGATTGG - Intergenic
912525931 1:110282577-110282599 CAGAGCAGAGTGGTGTTCACAGG - Intronic
913340920 1:117757530-117757552 CTGAGCACATTTATGTGGAGAGG + Intergenic
913941243 1:125109067-125109089 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
913956090 1:143295410-143295432 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
913981341 1:143520030-143520052 CAGAGGACAGTGAAGTGGCCAGG + Intergenic
914075714 1:144346685-144346707 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
914103464 1:144619811-144619833 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
915562727 1:156696818-156696840 CAGGGCACAGTGATGTGTAGAGG - Intergenic
916169187 1:161987946-161987968 CAGAGCACAGTGATGCGTCTGGG - Intronic
916317441 1:163465535-163465557 CACAGAACAATGATGTGGAATGG + Intergenic
920996077 1:210993029-210993051 CAGATCACAGCGATGTGGGTGGG - Intronic
921049868 1:211503643-211503665 CAGAGCCCAGTGAGGAGGGCAGG + Intergenic
924434087 1:244023284-244023306 CAGGGCCCAGAGCTGTGGACTGG - Intergenic
1064330179 10:14386361-14386383 CAGAGCACAGTGAGCTGGGCAGG - Intronic
1064864523 10:19864743-19864765 GAGAGCACAGGTAAGTGGACTGG + Intronic
1066782050 10:38961615-38961637 CAGAGGACAGTGAGGTGGCTAGG + Intergenic
1069291725 10:66788302-66788324 CTGAGCAGGGTGATTTGGACAGG + Intronic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1070809299 10:79289597-79289619 CAGGGCACACTGTTGTGCACTGG + Intronic
1072069944 10:91906637-91906659 CAGAGCCCACGGATGTGGAGGGG - Exonic
1072198309 10:93135925-93135947 CAGAGCTCACTTATGAGGACAGG + Intergenic
1074413730 10:113249308-113249330 CAGAGCATAGTGAGGGGAACAGG + Intergenic
1074571656 10:114629917-114629939 CAGAAAGCAGTGGTGTGGACTGG + Intronic
1074788496 10:116863293-116863315 CAGTGCACAGTGATATGGAAGGG + Intronic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075768205 10:124911627-124911649 CAGAGCACAGTGATTTGTGTTGG - Intergenic
1076117205 10:127908570-127908592 CAGAGCTCTGTGGTGTGAACAGG + Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1077182592 11:1223334-1223356 CAGAGCCCTGTGTTGGGGACGGG - Intronic
1077223608 11:1428044-1428066 CAGAGTACAGTAATGGGGAAAGG + Intronic
1077563515 11:3281281-3281303 CAGAGCCCATTGATGGGGCCGGG + Intergenic
1078025567 11:7691915-7691937 CAGTGCACAGCGATGTAGAAAGG - Exonic
1078142885 11:8704396-8704418 GAGAGCCCAGTGAGGTGGCCAGG + Intronic
1078550368 11:12276028-12276050 CACAGCACAGTGATGCGGAAGGG + Intergenic
1083110021 11:60397172-60397194 CACAGCCCAGAGATGTGGCCTGG + Intronic
1083199382 11:61110782-61110804 CATAGCACTGTGGTGAGGACTGG + Intronic
1084537106 11:69763752-69763774 CCGAGCACAGGGATGTGGGGAGG + Intergenic
1084601992 11:70151341-70151363 CAGAGCTGTGTGCTGTGGACAGG - Intronic
1084733163 11:71087519-71087541 CAGAGCACTGTGATGTCTAAAGG + Intronic
1086335355 11:85795348-85795370 CAGAGCACACTAATGTGAACTGG + Intronic
1086420347 11:86632156-86632178 AACAGCATAGTGGTGTGGACTGG + Intronic
1087966323 11:104421077-104421099 CAGAGTGCAGTGGTGTGAACAGG + Intergenic
1088100670 11:106152204-106152226 CCACGCACAGTGATGTGGGCAGG - Intergenic
1088392753 11:109333677-109333699 CAGAGAACAGTGGAGTAGACAGG + Intergenic
1089688594 11:120172262-120172284 CAGAGCACCGGGATGGGGAAAGG + Intronic
1091391720 12:130043-130065 CAGAGGACAGTGGTGAGGACAGG + Intronic
1092534617 12:9376485-9376507 CAGAGCCCAGTGAGGTGGGCAGG - Intergenic
1094608978 12:31974738-31974760 CAGGGGACAGTGAGGGGGACGGG + Intronic
1101430427 12:104622273-104622295 CAGATCACAGTTTTGTGGATGGG + Intronic
1102534496 12:113570441-113570463 CAGAGCCCGGTGAGGTGCACAGG + Intergenic
1103034899 12:117648559-117648581 CAGAGCACAGTCTTGTGGATGGG + Intronic
1103249102 12:119484841-119484863 CAGAGCACCCTGTGGTGGACAGG + Intronic
1104946238 12:132416050-132416072 CAGAGCTCAGTGAGGTGCCCTGG + Intergenic
1105852479 13:24348436-24348458 AAGGGCAAAGGGATGTGGACTGG - Intergenic
1108267299 13:48725006-48725028 GTAAGCACACTGATGTGGACTGG + Intergenic
1111587964 13:90307115-90307137 CAGAACACAGTGATATGGTTTGG + Intergenic
1113299573 13:109003155-109003177 CAGTGGAGAGTGATGTGGAGTGG - Intronic
1114309125 14:21450505-21450527 CTGAGCACTGTGATATGGGCCGG + Intronic
1119700808 14:76753224-76753246 CAGAGCACAGTGGTGAAGAGAGG + Intergenic
1119994716 14:79240758-79240780 CAGAGCAGTGTAATATGGACAGG + Intronic
1121098130 14:91232203-91232225 CAGAGCCCAGTCATGTGGTTTGG - Intergenic
1122641539 14:103162660-103162682 CTGTGCACAGTGACCTGGACGGG + Intergenic
1123082541 14:105702562-105702584 CAGGGCCCACTGATGAGGACTGG + Intergenic
1202938596 14_KI270725v1_random:118938-118960 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1123394605 15:19918954-19918976 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1124244097 15:28055629-28055651 CAAACCACTGTGATGTGGCCTGG - Intronic
1124375284 15:29125654-29125676 CAAAAGACAGTGATGAGGACTGG + Intronic
1125543804 15:40488239-40488261 CAGAGCCCAGTGGTGGGGAGGGG - Intergenic
1125898775 15:43326181-43326203 CAGAACACTGTGATGAGGCCAGG - Exonic
1126701056 15:51367869-51367891 CAGAGACCATTGATGTGGCCTGG - Intronic
1127013826 15:54660510-54660532 CAGAGTACAATGAGGTGGCCTGG - Intergenic
1127025617 15:54802321-54802343 CTGATCACAGAAATGTGGACTGG - Intergenic
1127585108 15:60370952-60370974 CAAAGAAGAGTGATGTGGATAGG + Intronic
1128751319 15:70152184-70152206 CAGAGCACTGTGCTGGGGAAAGG - Intergenic
1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG + Exonic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1131892294 15:96985087-96985109 CTGAGCTCAGCGAAGTGGACAGG - Intergenic
1132373752 15:101314909-101314931 CAGAGACCAGTGATGGGGAGGGG - Intronic
1132739476 16:1404302-1404324 CTGTGCACAGTGAGGTGGGCGGG - Intronic
1133975759 16:10598937-10598959 CAGAGCACAGAGGTGTTGATGGG + Intergenic
1135045020 16:19148210-19148232 CAGAGCACAGTAATGGGGTTTGG - Intronic
1136068195 16:27772496-27772518 CAGAGCACAGGGCTGAGGAAAGG + Intronic
1136611854 16:31371304-31371326 CAGAGCACCGAGCTGAGGACAGG - Intronic
1136697209 16:32094045-32094067 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136700641 16:32137053-32137075 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136767017 16:32790412-32790434 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136775246 16:32868324-32868346 CAGATCCCAGTGATGTAGAGAGG - Intergenic
1136797708 16:33037336-33037358 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136801132 16:33080289-33080311 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136863278 16:33715802-33715824 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1136887287 16:33937424-33937446 CAGGGCTCAGTGGTGTGGATGGG + Intergenic
1136895370 16:33993188-33993210 CAGATCCCAGTGATGTAGAGAGG + Intergenic
1136936779 16:34475664-34475686 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1136944955 16:34638273-34638295 CAGAGGACATTGAGGTGGCCAGG + Intergenic
1136947893 16:34677417-34677439 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136955284 16:34777301-34777323 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136959016 16:34823802-34823824 CAGAGGACAGTGAGGTGGCTAGG + Intergenic
1136963040 16:34872906-34872928 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1136967137 16:34927110-34927132 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137085105 16:36110741-36110763 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1137087743 16:36149224-36149246 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137092190 16:36207381-36207403 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1137221646 16:46458226-46458248 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1137264822 16:46860034-46860056 CTGACCTCAGTGATGTGGGCGGG + Intergenic
1137747928 16:50836831-50836853 GAGAGCACAGACATGTGGGCAGG - Intergenic
1138030283 16:53554352-53554374 CAGAGCTCTGTGATTAGGACAGG - Intergenic
1138121742 16:54405782-54405804 CTCAGCACAGTGACTTGGACAGG + Intergenic
1139326864 16:66159417-66159439 CAGAGAATATTGGTGTGGACAGG + Intergenic
1139367933 16:66445179-66445201 AAAAGCACAGTGAGGTGGCCGGG + Intronic
1140409310 16:74732305-74732327 TATAGCACAGGGATGTGGCCAGG + Intronic
1141468178 16:84220884-84220906 GAGGGCAGAGTGATGTGCACAGG - Exonic
1203069412 16_KI270728v1_random:1052658-1052680 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1203077663 16_KI270728v1_random:1130433-1130455 CAGATCCCAGTGATGTAGAGAGG - Intergenic
1203085166 16_KI270728v1_random:1180414-1180436 CAGGGCTCAGTGGTGTGGATGGG - Intergenic
1203124769 16_KI270728v1_random:1563953-1563975 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1143462438 17:7112580-7112602 CAGAGGAGAGTGAGGCGGACAGG + Intronic
1143554103 17:7650327-7650349 CAGAGCCAGGTGGTGTGGACAGG + Intronic
1144389609 17:14780968-14780990 CATAGATCAGTGATGTGGCCTGG + Intergenic
1144521587 17:15956048-15956070 CAGAGAACAGTGATCAGGAAAGG - Intronic
1144697061 17:17311977-17311999 CAGGGCACAGTGGTTTGGAGTGG + Intronic
1145017726 17:19410131-19410153 CAGAGCACAGAGAGGTGCAGTGG + Intergenic
1145324122 17:21785029-21785051 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1145326486 17:21833769-21833791 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1145689474 17:26722935-26722957 CAGAGGACAGTGAGGTGGTCAGG + Intergenic
1145978886 17:28999817-28999839 CAGAGCAGAGTGATGTGGGGTGG - Intronic
1146892445 17:36514761-36514783 TAGAGCAAAGTGATGTGCAGAGG - Intronic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1149138415 17:53399319-53399341 CACAACACAGTAATGTGGAAAGG + Intergenic
1149408032 17:56374988-56375010 CATAGCACAGGGCTGGGGACAGG + Intronic
1150851077 17:68704172-68704194 CAGAGGAAAGTGATGAGGATGGG + Intergenic
1151455623 17:74224024-74224046 CAGAGGACAGAGTTCTGGACAGG + Intronic
1151517672 17:74606732-74606754 CACAGCACAGGGATGCTGACGGG + Intergenic
1151751581 17:76041667-76041689 AACAGCACAGGGATGTGGGCAGG - Intronic
1152699349 17:81811359-81811381 CAGAGGACAGGGAGGAGGACGGG + Intronic
1203182742 17_KI270729v1_random:78899-78921 CAGGGGACAGTGAGGTGGCCAGG + Intergenic
1203190677 17_KI270729v1_random:184395-184417 TAGAGGACAGTGAGGTGGCCAGG + Intergenic
1153683196 18:7520612-7520634 CAGAGAGCAGAGATGAGGACAGG + Intergenic
1154516530 18:15173415-15173437 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1155068957 18:22296271-22296293 GAGAGCAGAGTGATGTGGAAAGG - Intergenic
1155198656 18:23498802-23498824 CTGACCACAGTGATCTTGACAGG - Intergenic
1156211963 18:34953961-34953983 CATTACACAGAGATGTGGACAGG + Intergenic
1156389553 18:36637777-36637799 AAGTGCACAAGGATGTGGACAGG + Intronic
1157014870 18:43699826-43699848 CAGATGACAGTGATATGGACAGG - Intergenic
1157327259 18:46678264-46678286 CTGAGAACAGTGTTGTGCACAGG + Intronic
1159896610 18:74002468-74002490 CAGAGGACATTGCTGTGCACTGG - Intergenic
1161479061 19:4501632-4501654 CAGCCCACAGTGATGGGCACAGG - Intronic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1164883337 19:31755411-31755433 CTGCGCACAGTGATGTGCTCAGG + Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165273703 19:34731640-34731662 CAGAGCAGCGTGCTGTGCACTGG - Intergenic
1168127437 19:54293712-54293734 CAGAGCACACAGATGTGCAGAGG + Intergenic
1168172919 19:54601136-54601158 CAGAGCACACAGATGTGCAGAGG - Intronic
1168560613 19:57379734-57379756 AAGAGCACAGTCATTGGGACTGG - Intronic
1168687774 19:58358706-58358728 CGGAGCACACAGGTGTGGACTGG + Intronic
1202668912 1_KI270709v1_random:30796-30818 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
924995666 2:358445-358467 CAGAGCTCAATGATGTGTACAGG - Intergenic
925146416 2:1585964-1585986 CAGAGCCCAGTTATGTCTACGGG + Intergenic
925179225 2:1806144-1806166 CAGAGCACAGTTGTGTGCCCAGG - Intronic
925344059 2:3157526-3157548 CAGAGCATCGTGATGGGGAAGGG - Intergenic
926323235 2:11763371-11763393 GAGTGGACAGTGATGTGGGCAGG + Intronic
926656564 2:15413835-15413857 CAGAGAACAGTGATGTTGTTGGG - Intronic
926772167 2:16388026-16388048 CAGAGCACACAAATGTGTACTGG - Intergenic
927930860 2:27042994-27043016 CATAGGACAGTGATGCTGACAGG + Intronic
929579015 2:43070115-43070137 CAGGGCACAGGTATGTGGGCAGG - Intergenic
929896510 2:45965534-45965556 CAGAGTACAGTGATTATGACTGG - Intronic
932096823 2:68857633-68857655 CAGAGCAGAGTCATATGCACAGG - Intergenic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
932631757 2:73350583-73350605 CTGTGCACAGAGGTGTGGACAGG - Intergenic
933259452 2:80115730-80115752 CAGAGCACAGCCACGTGGAAGGG + Intronic
934252377 2:90369071-90369093 CAGAGGACAGTGAGGTGGACAGG - Intergenic
934257064 2:91433874-91433896 CAGAGGACAGTGAGGTGGACAGG + Intergenic
934492773 2:94773071-94773093 CAGAGCACAGTGGTGAGCCCTGG + Intergenic
934525896 2:95051416-95051438 GGGTGCACAGTGATGGGGACAGG - Intronic
938516852 2:132018409-132018431 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
942386475 2:175448805-175448827 CAGAGCTCTTTGAAGTGGACAGG - Intergenic
946699655 2:222399208-222399230 CAGAGCACAGTCAGGTGAATTGG + Intergenic
946863509 2:224022280-224022302 TAGAGCACAGTGGTGTGATCTGG - Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948583016 2:239000726-239000748 CTGAGCTCAGTGGTGAGGACTGG - Intergenic
948597204 2:239087741-239087763 CTGGCCACAGTGATGGGGACAGG + Intronic
948617708 2:239212151-239212173 CAGATAAAAGTGATGTGAACTGG + Intronic
1168997466 20:2144016-2144038 CAGGACACAATGCTGTGGACAGG + Exonic
1170052880 20:12166093-12166115 GAGAGCCCAGTGTTGTGGCCTGG - Intergenic
1170394438 20:15910918-15910940 CAGAGCACAGAGATGGGTAGAGG - Intronic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1173105254 20:40127614-40127636 AAGAGCTCAGTGATGGGGTCAGG - Intergenic
1173414753 20:42845700-42845722 CAGAGCTCTGTGATCTGGTCTGG + Intronic
1173498955 20:43538737-43538759 CAGAGCACAGGGAAGAGCACAGG - Intronic
1173744795 20:45427991-45428013 AAGAGCACAGAGCTGTGGCCTGG + Intergenic
1174221211 20:48957007-48957029 CAGAGAACAGGGATGTGGGGAGG + Intronic
1175216700 20:57395077-57395099 CAGTGCACAGGCATGTGGGCTGG + Intronic
1176584719 21:8570195-8570217 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1178417903 21:32418684-32418706 CAGAGTACAGGGATGGGGCCAGG + Intronic
1178676311 21:34634512-34634534 CTGAGCACATGGAGGTGGACAGG - Intergenic
1178794834 21:35734319-35734341 GTCAGCACAGTGATGTGAACTGG - Intronic
1179727163 21:43347064-43347086 CAGACCACAGTGAGGGGGCCAGG + Intergenic
1180267530 22:10547097-10547119 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1181695244 22:24589742-24589764 CAGAGCCCAGGGCTGGGGACTGG - Intronic
1182447575 22:30398398-30398420 CAGAGGACACTAATGAGGACTGG - Intronic
1182518008 22:30869947-30869969 GAGAGCAAAGTGAGGTTGACTGG + Intronic
1182754868 22:32670975-32670997 CGGAGCAAAGTGTGGTGGACCGG + Intronic
1182948788 22:34351498-34351520 CAGTACACAGGGAGGTGGACAGG + Intergenic
1183160593 22:36110514-36110536 CAGAGAAAAGAGATTTGGACAGG + Intergenic
1183455241 22:37918961-37918983 GAGAGGGCAGTGATGTGAACAGG + Intronic
1184022347 22:41829211-41829233 CTGAGGACAGTGATGGGGAAGGG - Intergenic
1184068114 22:42131657-42131679 CAGAGCCCAGGAATGTGGGCTGG - Intergenic
1203302907 22_KI270736v1_random:89545-89567 TAGAGCCGAGTGATGTGGACTGG + Intergenic
1203325729 22_KI270738v1_random:14548-14570 CAGAGGACAGTGAGGTGGACAGG - Intergenic
949562464 3:5215056-5215078 AAAAGCACAGAGATGTGGGCTGG + Intronic
949818758 3:8092240-8092262 CAGAGAAAGGTCATGTGGACTGG + Intergenic
950665363 3:14491991-14492013 CAGAGCCCAGCGAAGTGGAGGGG + Exonic
950802750 3:15567717-15567739 CAGAACACAGTGCTGTGCACAGG + Intronic
950937186 3:16851117-16851139 CAGAGCATAGGGATTTGGATAGG + Intronic
951219777 3:20056980-20057002 TAGAGTACAGTGATGTGAGCTGG + Intronic
952338295 3:32423860-32423882 CAGAGGACAGTGACGGGCACAGG - Intronic
952407075 3:33014325-33014347 CAGAGCACAGTGAGCTGGGGAGG + Intronic
954847660 3:53574040-53574062 CAGAGCACAGTGCAATGGAAAGG - Intronic
955393330 3:58536806-58536828 GAGAGCAGAGTGAGGAGGACAGG - Intronic
957758147 3:84518771-84518793 CAGTGAACAGTGATGTGCATTGG - Intergenic
958666595 3:97147337-97147359 CAGAGCACAGTGAACTGCATGGG - Intronic
960444428 3:117730296-117730318 TAAAGCACAGTGATGTAGACAGG - Intergenic
961010933 3:123435344-123435366 TTGAGCACAGTGGTGTGGGCTGG + Intronic
962661919 3:137610500-137610522 CAGGGCACAGTGATGAGGAATGG - Intergenic
962694154 3:137931155-137931177 CAGAGCAGATGGCTGTGGACTGG - Intergenic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
962907366 3:139816878-139816900 GAGAGCACAGTGATGGGGTGGGG - Intergenic
964698173 3:159533627-159533649 CAGAGAACAGAGATGTGGGGGGG - Intronic
965040899 3:163505667-163505689 CACAGCACACAAATGTGGACTGG + Intergenic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
975809713 4:78154527-78154549 GAGAGTACAGTGATGAAGACTGG - Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
982075483 4:151732415-151732437 CAGAGCACAGGGTTGGGGGCAGG - Intronic
983131314 4:164022985-164023007 CAGAGGACAGAGGTGTGGCCTGG + Intronic
985005618 4:185532496-185532518 CAGAGGACAGTGGTGTGGTGTGG + Intronic
985935596 5:3095313-3095335 CAGAGCACTGTCTTGTAGACTGG + Intergenic
987250922 5:16100509-16100531 TAGAGCCCAGTGATGTGGAGTGG + Intronic
988621729 5:32830083-32830105 CAGAGCACAGTGAGGTCTGCAGG - Intergenic
988774625 5:34466822-34466844 GAGGGCACTGGGATGTGGACTGG + Intergenic
992596782 5:78355280-78355302 CACACCACAGTGGTGTGGACAGG + Intergenic
993452020 5:88083679-88083701 AACAGCACAGTGATTTGCACAGG - Intergenic
994837586 5:104875581-104875603 TAGAGCACAGTGATGAGTCCGGG + Intergenic
997107893 5:131042191-131042213 CAGTGCACAGTGACCTAGACAGG + Intergenic
1000664732 5:163980509-163980531 AAGATCACATTGATATGGACAGG - Intergenic
1004902100 6:20204493-20204515 CAGAGCAATGTGATATGGATAGG + Intronic
1005686987 6:28262598-28262620 CAGGGCAGTGTGATGTGGAAGGG + Intergenic
1006429070 6:33984106-33984128 CCCTGCACAGTGCTGTGGACAGG - Intergenic
1007361126 6:41356678-41356700 CACAGAACATGGATGTGGACAGG - Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1012801733 6:103838563-103838585 CACAGCACAGTGTAGCGGACTGG - Intergenic
1014374305 6:120653322-120653344 GAGAGCATTGTGATGGGGACAGG - Intergenic
1017808197 6:157964634-157964656 TGGAGCACAGTGGTGTGAACAGG - Intergenic
1018181414 6:161226701-161226723 GATAGCACATTGATGTGGCCAGG + Intronic
1018526102 6:164711010-164711032 CACATCACAGTGATACGGACAGG - Intergenic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1019413493 7:916918-916940 CAGAGCCCAGGGAGGTGCACGGG + Intronic
1020434651 7:8149890-8149912 GAGGCCACAGTGATGTGTACTGG + Intronic
1021621341 7:22553447-22553469 CTGAGCACAGTGATGGGGATTGG - Intronic
1021862629 7:24922268-24922290 AAGGGCACAGTGAGGGGGACTGG + Intronic
1023649279 7:42351709-42351731 AAGAGCACACTCATGTGGAGTGG - Intergenic
1024517943 7:50275896-50275918 CAGACCACAGTGATGTGACCAGG + Intergenic
1024807265 7:53157848-53157870 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025039093 7:55624105-55624127 CGGAGTACAGTGGTGTGGTCTGG + Intergenic
1025305931 7:57855324-57855346 CAGAGGAGAGTGAGGTGGCCAGG - Intergenic
1025319425 7:58078347-58078369 CAGAGAACAGTGAGGTGGCCAGG + Intergenic
1025477842 7:60948817-60948839 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025483263 7:61013082-61013104 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025489245 7:61091705-61091727 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025554288 7:62285128-62285150 CAGAGGACAGTGAGGTGGCCAGG - Intergenic
1025560493 7:62368146-62368168 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1025610648 7:63073223-63073245 CAGAGGGCAGTGATGTGCCCAGG + Intergenic
1028692775 7:93672573-93672595 GAGAGAACAGTGATGTGAAGTGG - Intronic
1029619618 7:101681792-101681814 CAGGGCACAGGGATGGGGAGGGG - Intergenic
1030013029 7:105189983-105190005 CAGAGCACAGTTGTGTGGCATGG - Intronic
1030416164 7:109246299-109246321 TGAAGCACAGTGATGTGGACTGG + Intergenic
1030669155 7:112315912-112315934 CAGGGGACAGTGATCTGGAGAGG - Intronic
1033368047 7:140686049-140686071 CACACCTCACTGATGTGGACAGG + Intronic
1034350473 7:150411816-150411838 CACAGCACAGTGATGGGCAGAGG - Intronic
1035829245 8:2676611-2676633 CAGAGTGCAGTGGTGTGAACAGG + Intergenic
1036774399 8:11600153-11600175 CGGAACACAGTGGTGTGGTCAGG + Intergenic
1037747307 8:21656767-21656789 CAGAGAACAGTGATATGGTTTGG + Intergenic
1038647308 8:29372690-29372712 CAGTGCTCACTGATGTGCACAGG + Intergenic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1041835602 8:62209874-62209896 CAGAGCATAATGATGTGTCCAGG + Intergenic
1042805247 8:72764176-72764198 CAGAGCACAGTGACGGAGAAAGG + Intronic
1042824493 8:72966355-72966377 CTGAGCACAGTGATTTGTTCAGG - Intergenic
1042862512 8:73328493-73328515 AAGAGCTCAGTGTTGTGGATTGG + Intergenic
1042935486 8:74054075-74054097 TAGAGTACAGTGCTGTGAACAGG + Intergenic
1043919589 8:85965824-85965846 CAGAGCACAGTGGAGAGGACTGG + Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1046301609 8:112300557-112300579 CAGAGCAGAGTGGTGAGGATAGG - Intronic
1048251633 8:132871099-132871121 CAGAGCACGGTCCTGTGGAGGGG - Intronic
1049750799 8:144282699-144282721 CAGAGGATAGGGATGAGGACAGG - Intronic
1050578059 9:7020002-7020024 GAGATCATAGTGATGTGGGCTGG + Intronic
1052722035 9:32183601-32183623 GAGAGAATGGTGATGTGGACAGG + Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053480198 9:38410911-38410933 CAGCACACAGTGCTGAGGACAGG + Intronic
1055837108 9:80456404-80456426 CAGAGGACAGTGAGGTTAACAGG + Intergenic
1057009706 9:91590438-91590460 CAGAGCATTCTGATGTGGAGGGG - Intronic
1057420278 9:94906737-94906759 CAAACCAAACTGATGTGGACTGG - Intronic
1057577393 9:96254300-96254322 CAGAGCACAGACATGGGGAAGGG + Intronic
1058351318 9:104028072-104028094 CACAGCACAGTGGTGGGGAGGGG + Intergenic
1058901501 9:109446353-109446375 CAGCACACAGTGCAGTGGACAGG - Intronic
1059357244 9:113709551-113709573 GACAGCACACTGATGTGCACAGG + Intergenic
1060697537 9:125722218-125722240 TAGAGCACAGTGGTGTGATCTGG + Intergenic
1203614624 Un_KI270749v1:47717-47739 CAGAGGACAGTGAGGTGGCCAGG + Intergenic
1187361865 X:18635873-18635895 CAGAGCTGAGTAATGTTGACAGG - Intronic
1187824628 X:23322432-23322454 CTGCCCACAGTGATGGGGACTGG + Intergenic
1188704831 X:33314748-33314770 CAGAGTAATGTGATGTAGACTGG - Intronic
1190427367 X:50345818-50345840 CAGAGAAAAGTGATGTGCTCAGG - Intronic
1191899970 X:66030911-66030933 CAGTGCAGAGTGAGGTGGAAGGG + Intronic
1191912723 X:66168166-66168188 CAGAGGACAGTGATATGAAGAGG + Intronic
1192148878 X:68699633-68699655 CAGAGGACAGTGATGAGGCTGGG - Intronic
1192219495 X:69187783-69187805 CAGAGCCCAGAGCTGAGGACTGG + Intergenic
1201108853 Y:10784033-10784055 CAGAGCGGAGTGGAGTGGACTGG - Intergenic
1201117420 Y:10845302-10845324 CAGATCAGAGTGAAGTGGAGAGG - Intergenic