ID: 1040483740

View in Genome Browser
Species Human (GRCh38)
Location 8:47851115-47851137
Sequence CAGAGTAAACATAAAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040483740 Original CRISPR CAGAGTAAACATAAAGAAGT TGG (reversed) Intronic
903679003 1:25084512-25084534 CATAGAAAACAAAAAGAAGAGGG + Intergenic
904874772 1:33645931-33645953 CAGACAAAACAGAAAGAAATGGG - Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906457389 1:46008818-46008840 GAGAGTACACAGACAGAAGTAGG + Intronic
906600182 1:47119924-47119946 CAGAGATAACACAAACAAGTGGG + Intergenic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
906756268 1:48319239-48319261 CAAAGAAAACATAGAAAAGTTGG + Intronic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
906996490 1:50800495-50800517 AAGATTAAACAAACAGAAGTTGG + Intronic
907328920 1:53658857-53658879 CAGAGTAGGCACAAAGAAGCTGG + Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
908662420 1:66451444-66451466 CACACAAAACAAAAAGAAGTTGG + Intergenic
909177990 1:72383989-72384011 AAAAGCAAAAATAAAGAAGTGGG + Intergenic
909312509 1:74170818-74170840 TAAAGTAGACATAAATAAGTTGG - Intronic
909385038 1:75045028-75045050 CAGACTAAAAATAAAGGAATGGG + Intergenic
909431537 1:75592971-75592993 CAAAGTAAACATGAACAAATGGG + Intronic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
909787650 1:79635958-79635980 CACAGTGAAAATTAAGAAGTAGG + Intergenic
909818160 1:80023918-80023940 CAAAGTAAAAATAAAAAAGGTGG - Intergenic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
910256388 1:85251562-85251584 TAGAGAAAACATGTAGAAGTAGG + Intronic
910293393 1:85620202-85620224 CAGAGTATACAGAAAGTAATTGG - Intergenic
910378803 1:86602920-86602942 CAAAGTAAAAATAAACAAATAGG - Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
910528166 1:88204880-88204902 CAAAGTAAACACACAGAACTTGG - Intergenic
910570693 1:88699217-88699239 CAGAGAAAATTTAAAGAAATAGG - Intronic
912228742 1:107767404-107767426 GAAAGTAAACATGAAGATGTGGG + Intronic
913378249 1:118179572-118179594 CAAAGCAAAAATAGAGAAGTGGG + Intronic
914858394 1:151368391-151368413 CAGAGTCAGCAGATAGAAGTAGG - Intronic
915452749 1:156018082-156018104 TAGAGTAGACATGAAGAAGGAGG - Intronic
915771166 1:158426294-158426316 CACAGTGACCATAAAGCAGTAGG + Intergenic
917690585 1:177464154-177464176 CTAAGTAAACACAGAGAAGTGGG - Intergenic
918659268 1:187069882-187069904 CAGAATATGGATAAAGAAGTAGG + Intergenic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920618257 1:207516708-207516730 CAGAATAAAGATAATGAAATAGG - Intronic
920851171 1:209628728-209628750 ATGAGTAAACATAAAGCAGGGGG + Intronic
921087409 1:211808708-211808730 CAGGGTAAATATCCAGAAGTGGG - Intronic
921211720 1:212906385-212906407 AAAAGCAAACATAAACAAGTGGG + Intergenic
921663917 1:217843713-217843735 TAGATTATACATAAATAAGTGGG + Intronic
922232604 1:223699874-223699896 AAGAGTAAACGTAAAGAATAAGG - Intergenic
924093604 1:240527418-240527440 CTGAGTACACACTAAGAAGTTGG - Intronic
924812256 1:247413655-247413677 AAAAGTAAAGATAAATAAGTGGG - Intergenic
1063861980 10:10320185-10320207 CACATTAAAAATAATGAAGTTGG + Intergenic
1065365136 10:24928223-24928245 GAGAGGAAAAATAAAGAAATAGG - Intronic
1065413311 10:25455025-25455047 CAGGCTAGAAATAAAGAAGTGGG - Intronic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1068534432 10:58225544-58225566 TAGAGTATACAGAAAGAATTTGG - Intronic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1070365565 10:75733552-75733574 CAGAGCAAACAAAAATGAGTGGG + Intronic
1071694562 10:87858069-87858091 CAGAGTAAAGGTAAAGCAATAGG - Intergenic
1071797863 10:89025380-89025402 AAAAGGAAGCATAAAGAAGTGGG + Intergenic
1074255655 10:111799789-111799811 CATAGAAAAAATAAACAAGTTGG + Intergenic
1075281025 10:121138521-121138543 CAGAGAAATCATTAAGGAGTGGG + Intergenic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1076223316 10:128752959-128752981 CTGAGTAAACATCTAGGAGTGGG - Intergenic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1077964454 11:7113809-7113831 CAAAGTAAATAGAAAGAAATGGG + Intergenic
1078849018 11:15147026-15147048 CAAAGTAAAAATATTGAAGTGGG - Intronic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1079534873 11:21501900-21501922 CAGATTAAACTTTAAGAACTTGG - Intronic
1079633284 11:22704747-22704769 CAGAATAAACAAAATGCAGTGGG + Intronic
1079703230 11:23575851-23575873 CAGAGAATACATAAATAAATGGG + Intergenic
1080149030 11:29025925-29025947 CAGAGGAATAATAGAGAAGTTGG - Intergenic
1080340068 11:31251916-31251938 CTAAGTAAAGATAGAGAAGTTGG + Intronic
1080989821 11:37518023-37518045 CAGAGTGAAAATAAAGGAATGGG + Intergenic
1081043765 11:38245792-38245814 CAGATTACTCATAAAGAACTAGG - Intergenic
1081276116 11:41150890-41150912 CAGAGAAAACATACAGATGATGG + Intronic
1082180885 11:49117886-49117908 TAGAGAAAACATAAAGATGTAGG + Intergenic
1083041930 11:59696915-59696937 CAAAGCAAAAATAAACAAGTTGG - Intergenic
1083133058 11:60645038-60645060 CAAAGCAAAAATAAACAAGTGGG - Intergenic
1084321172 11:68374101-68374123 GACAGGAAACAAAAAGAAGTCGG + Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1085228041 11:74940493-74940515 CAGAGCATAAATAAAGAAATGGG + Intronic
1085825809 11:79846018-79846040 AAGAGTAAATCTAAAGAAGGTGG + Intergenic
1086031510 11:82363287-82363309 GAGAGTAAACATATATAAATTGG + Intergenic
1086415353 11:86583945-86583967 AACAGTAAAAATAAACAAGTGGG + Intronic
1086575860 11:88338210-88338232 CAGAGGAAAAAACAAGAAGTTGG - Intergenic
1086837709 11:91645830-91645852 CAGATTAAACATAGAAAATTTGG + Intergenic
1087289867 11:96308675-96308697 AAGCTGAAACATAAAGAAGTAGG - Intronic
1087533378 11:99412019-99412041 CAGAATAAAAATAAAGAAATGGG + Intronic
1087713258 11:101579073-101579095 AAAAGAAAACATATAGAAGTGGG - Intronic
1088072090 11:105799555-105799577 CAGGGTAGACATAAAGGATTTGG + Intronic
1088138942 11:106592395-106592417 CATAGTGAACATGGAGAAGTGGG - Intergenic
1088535972 11:110861877-110861899 CAGAGAAAAATTAAACAAGTGGG - Intergenic
1088729478 11:112668225-112668247 CAGAGTAAAGCTAAAGGAGAAGG - Intergenic
1089341629 11:117761874-117761896 AAGAGAAAACACAAAAAAGTGGG + Intronic
1090234197 11:125134388-125134410 AAGAATAAACTTAAAGAAGGTGG - Intergenic
1092631241 12:10380391-10380413 AATAATAAACATAAAGAAGGAGG + Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093757011 12:22863540-22863562 AGAAGTAGACATAAAGAAGTAGG - Intergenic
1094346939 12:29480766-29480788 CAGAGATAATATAAAGAAGGAGG - Intronic
1094661744 12:32475899-32475921 CAGAGGAAATATAAAGAAGTTGG - Intronic
1095245156 12:39911196-39911218 CAGAGTGAACATGAAAATGTTGG + Intronic
1095415199 12:41969067-41969089 TAGGGTAAATTTAAAGAAGTGGG - Intergenic
1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097920699 12:65069407-65069429 CATAGTAAACATAAACCAGTGGG - Intronic
1097942768 12:65330520-65330542 GAAAGTACACATACAGAAGTTGG - Intronic
1098482845 12:70985819-70985841 CATAGTAAATATAAAACAGTAGG - Intergenic
1098552406 12:71777466-71777488 GAGAATAAAAATCAAGAAGTGGG - Intronic
1099163906 12:79277794-79277816 CAGAGTCAAGATAAAAGAGTGGG + Intronic
1099201434 12:79681878-79681900 CAGAGTTAACATTCAGAAGATGG - Intronic
1099800364 12:87449916-87449938 AAAAGCAAAGATAAAGAAGTGGG + Intergenic
1100298178 12:93282136-93282158 CAGAGGACACATAAACGAGTAGG - Intergenic
1102850208 12:116235679-116235701 CTGAGTTAACAAAAAGGAGTAGG - Intronic
1105679474 13:22710937-22710959 CAGAGAAAATATAAAAAACTAGG - Intergenic
1106987268 13:35370395-35370417 CAGACTAAAAATAAAGGAATGGG - Intronic
1107729575 13:43334861-43334883 CAGGGGAAACTTACAGAAGTGGG + Intronic
1108726009 13:53182261-53182283 CAGATTACACATGAAGAAGCAGG - Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109154925 13:58897283-58897305 TAGAGTAAACACAAATAACTTGG + Intergenic
1109340915 13:61057576-61057598 CATGGTAAATATAAAGAATTGGG - Intergenic
1109477915 13:62908730-62908752 CAGTGTAAATAGAAAGAACTAGG - Intergenic
1109991215 13:70060053-70060075 CAGAGAATACATAAGGAACTTGG + Intronic
1111138274 13:84080301-84080323 CAGGCTAAACATAAAGACGGTGG + Intergenic
1111480268 13:88815027-88815049 CAGAGTTAACCTGAAAAAGTAGG - Intergenic
1111757435 13:92416214-92416236 AAGAGTCATCATAAATAAGTTGG - Intronic
1112181046 13:97081079-97081101 CAGACAAAACAGAAACAAGTGGG - Intergenic
1112781645 13:102907110-102907132 GATAATAAACATAAAGAACTAGG - Intergenic
1113176039 13:107565023-107565045 CTGTATAAACACAAAGAAGTAGG + Intronic
1113705778 13:112432186-112432208 CAGAGAAAGCACAAAGATGTAGG + Intronic
1114203430 14:20544828-20544850 CAAAATAAAAATAAATAAGTGGG - Intergenic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1116277060 14:42848698-42848720 CATCCTAAACATAAAGAAGCAGG - Intergenic
1116674654 14:47890034-47890056 CACAGTAAAAAAAAAGAACTAGG + Intergenic
1116955329 14:50917309-50917331 CAGATAAAAGATAAAGAGGTTGG + Intronic
1117595586 14:57324151-57324173 CAGAGGAAAAAAAAAAAAGTAGG - Intergenic
1118266723 14:64301734-64301756 CAGAGAAAAATCAAAGAAGTTGG - Intronic
1118435488 14:65767365-65767387 CAGATCAAACATGGAGAAGTAGG + Intergenic
1118689576 14:68325159-68325181 CATTTTAAACATTAAGAAGTTGG - Intronic
1119105263 14:71917381-71917403 AAAAGTATACATAAAGCAGTTGG + Intergenic
1123777504 15:23594808-23594830 CAATGTAAACATAAAGAAAAAGG + Intronic
1124607474 15:31180795-31180817 CAGAGAGAAAATAAAGAAATAGG + Intergenic
1125445808 15:39754699-39754721 CAGAGAAAACATATAAAAGAAGG + Intronic
1126413992 15:48398995-48399017 CAGAGTAAACATGCAGAATTGGG - Intergenic
1127163871 15:56222750-56222772 CAGAGACAACATAAAATAGTTGG + Intronic
1127731316 15:61804766-61804788 AATAGTATTCATAAAGAAGTAGG + Intergenic
1127972987 15:63976845-63976867 CTGACTAAACAAAAAGAAATAGG - Intronic
1127991703 15:64123648-64123670 TTGAGTAAACATGAAGATGTTGG - Intronic
1128102238 15:65011862-65011884 CAGACTAAAAATAGAGAAATTGG - Intronic
1128147404 15:65339611-65339633 CTGAGCAAACATGAGGAAGTGGG + Intronic
1128667905 15:69552201-69552223 CACAGAAATCATAAAGAAGCAGG + Intergenic
1129004713 15:72362985-72363007 CAGAGTAGACATTAAAGAGTGGG - Intronic
1129067704 15:72921308-72921330 CAGAATAGAAATACAGAAGTTGG - Intergenic
1130804297 15:87302471-87302493 CAGAGAACTCATAAAGCAGTGGG + Intergenic
1131275574 15:90977888-90977910 AAGAGTAAACATAAATAAGGAGG - Intronic
1131530579 15:93188009-93188031 CAGAGCAGACATTTAGAAGTAGG - Intergenic
1133594413 16:7277135-7277157 CAGAAGAAACATTAAAAAGTTGG + Intronic
1133957886 16:10462275-10462297 AAGAGAAAACATAAATATGTGGG - Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134283802 16:12842478-12842500 CAGAGGAAACAAATTGAAGTAGG - Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1138871497 16:60893419-60893441 CCGGGTAAATATAGAGAAGTGGG + Intergenic
1139055718 16:63181191-63181213 TAGAGTAAACACCTAGAAGTGGG + Intergenic
1139076914 16:63462657-63462679 CAGAGTTAAAATAAAAAAGAAGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140240721 16:73197475-73197497 ATGAGTAAACATAAAGCAATTGG + Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143132575 17:4689070-4689092 CAAAGCAAACAAAAACAAGTGGG + Intronic
1143390829 17:6558245-6558267 CAGCATACACATAACGAAGTGGG + Intergenic
1144173274 17:12680647-12680669 CACAGAATACATAAACAAGTGGG + Intronic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147358097 17:39913275-39913297 AAAAGTAAAGCTAAAGAAGTAGG + Intronic
1153117243 18:1674259-1674281 CAAAGAAAACATAAAGTAGAAGG + Intergenic
1153666194 18:7369497-7369519 CAGAGTAAACATTAATAATAAGG - Intergenic
1155810184 18:30223104-30223126 CAGTTTAAACATAAAGTAATAGG - Intergenic
1155924230 18:31637117-31637139 AAGTGTAAATATAAAGAATTTGG - Intronic
1156593392 18:38517762-38517784 CAGACTTAACAGAAAGCAGTAGG - Intergenic
1156698333 18:39795098-39795120 CAGAGTAATCCTAAAGATCTGGG - Intergenic
1157054535 18:44210874-44210896 CAGAGGTAACACAAATAAGTGGG - Intergenic
1157183626 18:45519624-45519646 CAGAGTAAGCACGAAGAAGGAGG + Intronic
1157629802 18:49083143-49083165 CAGACAATACATAAATAAGTGGG + Intronic
1158194747 18:54872178-54872200 CAGAGAACACATAAAGCTGTCGG - Intronic
1159803387 18:72927033-72927055 CAGAGAAAACCAAAAGAAATAGG + Intergenic
1161960140 19:7518761-7518783 AAAAATAAAAATAAAGAAGTGGG + Intronic
1163885700 19:19962915-19962937 CAGAGTCTACATACAGAACTGGG + Intergenic
1163949364 19:20569735-20569757 CAGAGTCTACATACAGAACTGGG + Intronic
1165247636 19:34506323-34506345 AAGAATAAACAGAAAGAAATCGG + Exonic
1165280212 19:34790890-34790912 AAAATTAAAAATAAAGAAGTTGG + Intergenic
1168163715 19:54532214-54532236 CAGAGAAAACATCAAGAACCAGG + Intergenic
1168164104 19:54534730-54534752 CAGAGAAAACATCAAGAACCAGG + Intronic
1168467830 19:56618556-56618578 CTGAGTGTTCATAAAGAAGTGGG + Intronic
927073997 2:19558521-19558543 GAAAATAAACATTAAGAAGTAGG - Intergenic
928551237 2:32372952-32372974 CAGGGTAAATACACAGAAGTGGG + Intronic
928652319 2:33416310-33416332 CAGAATAAACCTAAAGAAAATGG - Intergenic
930587812 2:53290232-53290254 CAGACTTTGCATAAAGAAGTAGG - Intergenic
931509210 2:62971479-62971501 CCAAGTATACATAAAGAACTGGG + Intronic
932285729 2:70530146-70530168 AAAAGCAAACATGAAGAAGTAGG + Intronic
932876070 2:75453898-75453920 CAGTTTGAACATAAACAAGTGGG + Intergenic
933418006 2:82011817-82011839 AAAAGTAAACAAAAAAAAGTTGG - Intergenic
934964743 2:98710968-98710990 CAGTGGTCACATAAAGAAGTTGG + Intronic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936495366 2:113015817-113015839 GACAGTAAAAATAAAGAAATGGG - Intergenic
936768452 2:115882720-115882742 CAGAGAAAAAATGTAGAAGTGGG - Intergenic
936815720 2:116457647-116457669 CAGTGAAAAGAAAAAGAAGTTGG + Intergenic
937473343 2:122192078-122192100 AAGAGTAATCATAAAGACATGGG - Intergenic
940371134 2:152902099-152902121 CAGAGAAAACAAATAGAACTTGG + Intergenic
941195803 2:162450110-162450132 CAGAGTTCACATTAAGAATTAGG - Intronic
941238155 2:163001689-163001711 AAAAGTAAAAATAAACAAGTGGG + Intergenic
941302576 2:163822213-163822235 CAAAGTAAAAATAAACAAATGGG - Intergenic
941358361 2:164520230-164520252 CAAAGCAAACAAAAAAAAGTGGG + Intronic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941873797 2:170412906-170412928 CAAATTAAATAGAAAGAAGTGGG - Intronic
942983679 2:182113180-182113202 CTGGGCAAACATAAAGAATTTGG + Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943400770 2:187407932-187407954 CAAAGTTAACATATAGAGGTGGG - Intronic
944091103 2:195912754-195912776 GGGAGAAAACAGAAAGAAGTAGG - Intronic
944610150 2:201395309-201395331 CAGCACAAACTTAAAGAAGTAGG - Exonic
945811556 2:214555672-214555694 TAGAGGAAACATTTAGAAGTGGG - Intronic
946456376 2:219830043-219830065 AACAGTAAACATAAACAAGAAGG + Intergenic
947115194 2:226762590-226762612 CAGACAATACATAAAGAAATGGG + Intronic
947654266 2:231812878-231812900 AAGAGAACACTTAAAGAAGTGGG - Intergenic
1169015262 20:2287578-2287600 CATAATAAACATAGAGTAGTAGG + Intergenic
1169652303 20:7882858-7882880 AAGAGTAAAGAAAGAGAAGTAGG + Intergenic
1170585446 20:17730752-17730774 CAGAGTGGACAGAAAGGAGTTGG - Intronic
1170943494 20:20868708-20868730 CAGACTAAAAATAAAAAAGGAGG + Intergenic
1173005553 20:39137294-39137316 CAGAGTGGACATAAAGAGATTGG + Intergenic
1174041963 20:47706486-47706508 CAGACAAGACATAAACAAGTGGG + Intronic
1175024232 20:55884678-55884700 AAGAGAAAACATTATGAAGTTGG + Intergenic
1176127308 20:63481811-63481833 CAGAGTAAAGACAGAGCAGTGGG + Intergenic
1177492972 21:21852608-21852630 CAAACTAAACATAGAGAAGAAGG - Intergenic
1177873044 21:26596653-26596675 TACATTAAACATAAAGAATTAGG + Intergenic
1180282256 22:10712708-10712730 CAGAATAGAGGTAAAGAAGTGGG + Intergenic
1180681442 22:17629649-17629671 CACAGTAAAAAGAAAAAAGTGGG - Intronic
1181963088 22:26637157-26637179 CAGGGTACACACAAAGAACTTGG + Intergenic
1181985020 22:26794398-26794420 CAGAAAAAAAAAAAAGAAGTAGG + Intergenic
1182138250 22:27927877-27927899 TACAGTAAACATAAAAAAATTGG - Intergenic
1183970998 22:41477453-41477475 CAGAATAAAACTAAAGAGGTCGG - Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1185196387 22:49473130-49473152 CAAAGTAAAAGTAAAGAAATTGG - Intronic
1185252183 22:49809118-49809140 CAGAGGAAAAATAAAGAAAAAGG + Intronic
949495849 3:4631326-4631348 CAGATTAACCATAAAGAAATAGG - Intronic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
951002520 3:17580372-17580394 CAGAAGAAGCCTAAAGAAGTGGG + Intronic
951620044 3:24591782-24591804 CACAGTAGAGATACAGAAGTAGG + Intergenic
952214785 3:31267545-31267567 CAGAGGAAACACAAAGGAATGGG - Intergenic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
955681888 3:61510281-61510303 CAGAGTAAACCCAAATAAGTAGG - Intergenic
956193046 3:66625291-66625313 AAGAGTAAAAATAAAGAAAGTGG + Intergenic
956326216 3:68055783-68055805 CAGAGCATAGATAAAGAAGATGG - Intronic
956603691 3:71050260-71050282 CAGAGGGCACATAAAGAAATGGG - Intronic
957115546 3:76019793-76019815 CAGAGAAAACCTAAACATGTGGG - Intronic
957563985 3:81861685-81861707 CAGGGTAAACATAAAAGAGAGGG + Intergenic
957599633 3:82317718-82317740 CCAGGTAAACATGAAGAAGTGGG - Intergenic
957642634 3:82876732-82876754 CAGAATAACTATAAATAAGTAGG + Intergenic
957809461 3:85200708-85200730 CAGAGTACAAATAAAAATGTTGG + Intronic
957904082 3:86535635-86535657 AAAAGCAAACATAAACAAGTAGG + Intergenic
958437136 3:94110879-94110901 CAGATTAAACAGCAAGAACTGGG + Intronic
958437285 3:94112593-94112615 CAGATTAAACAGCAAGAACTGGG - Intronic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
958943176 3:100336408-100336430 CAAAGTATAGAGAAAGAAGTAGG + Intronic
959116060 3:102179697-102179719 CAGAGTAAACATGAACAAACTGG - Intronic
960013705 3:112861330-112861352 CAAAGAAAACATAAAGAAATGGG - Intergenic
961970379 3:130957920-130957942 CATTGTAAACATAAAGTAGAAGG + Intronic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
964065698 3:152576113-152576135 CACAGTAAACATAAAAAACAAGG - Intergenic
964334214 3:155637769-155637791 CTGAGTAAACATACTAAAGTAGG - Intronic
965088048 3:164124960-164124982 CTGAGAAAGCATAATGAAGTTGG + Intergenic
966701673 3:182860375-182860397 CAGATCATACATAAAGAATTGGG - Intronic
966773792 3:183526448-183526470 CAGAGTCAACAGAAATCAGTGGG + Intronic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967599864 3:191373452-191373474 CAAAATAAACAAAAAGAATTGGG - Intronic
969233067 4:5845343-5845365 CAGATTAACCAAAAAGCAGTAGG - Intronic
971548301 4:27915259-27915281 CAGATTAAAACTTAAGAAGTAGG - Intergenic
971604732 4:28643121-28643143 CCTAGGAAACATAAATAAGTAGG + Intergenic
972204118 4:36750372-36750394 AAAAGTAAAAATAAAGAAATGGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973753635 4:54049783-54049805 GAGAGAAAAAATAAAAAAGTAGG + Intronic
973843026 4:54881640-54881662 GAGAGTTAACTTTAAGAAGTGGG - Intergenic
973862707 4:55080898-55080920 CAGTTTTAACATGAAGAAGTTGG - Intronic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
974688211 4:65260107-65260129 CAGATTAAATATTAACAAGTTGG + Intergenic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
976227154 4:82804270-82804292 TGGATTAAACATAAAGAAGGAGG + Intergenic
976229715 4:82828999-82829021 CAGAGTACCCAAAAAGAAGAAGG - Exonic
977325234 4:95566455-95566477 CAAAGCAAACATAGAGAAATAGG - Intergenic
977460889 4:97323763-97323785 CAGAGTAATTAAAAATAAGTTGG + Intronic
977492703 4:97734740-97734762 AAAAGCAAACATAAACAAGTAGG + Intronic
978340175 4:107714219-107714241 AAGAGGAAACATTAAGAATTAGG - Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
980740902 4:136948886-136948908 CACAGCAAACATAAAAAAGCAGG - Intergenic
981867286 4:149438154-149438176 CAGGGTAAAGATAAAGGATTAGG - Intergenic
982739997 4:159047398-159047420 CAGAGAAAATATAAAGAATCAGG - Intergenic
983263196 4:165478861-165478883 AGTAGTAAAAATAAAGAAGTTGG - Intronic
983480297 4:168265464-168265486 CAGAATGAACATAAAGACTTAGG - Intronic
983722938 4:170880815-170880837 CAGAGTAACCAAAAAGGAGCGGG - Intergenic
984176172 4:176420176-176420198 CAAAGTAAACATAAACAATTTGG - Intergenic
984233485 4:177129392-177129414 CACAGGAAACATGAAGAAGCAGG - Intergenic
984911971 4:184682288-184682310 CAGAATAAACAAAAAGGAGTTGG + Exonic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986953934 5:13126989-13127011 CAAAGTAAAAATAAACAAGTGGG - Intergenic
987021795 5:13880660-13880682 CAGGGTAAACATAAAGCAAAAGG + Intronic
987264805 5:16242182-16242204 CAAAGCAAAAATAAACAAGTGGG + Intergenic
987842804 5:23242400-23242422 CAGGGTAAACATCAATAATTTGG + Intergenic
988376630 5:30443672-30443694 CAAAGTAAACATGAACAAATGGG + Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
989398105 5:40980161-40980183 CAGAGTAAAAATCATGAAGGTGG - Intronic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
990204636 5:53415590-53415612 CAGTGTATACATAATGAAATGGG - Intergenic
990688231 5:58332669-58332691 TAGAGCAAAGATAAAGAAGGGGG - Intergenic
990694714 5:58402820-58402842 CAGAGTAAACGTGAAGAGGTAGG + Intergenic
991225668 5:64268493-64268515 CAGAGCATACATACACAAGTAGG - Intronic
991334767 5:65534919-65534941 CAGAGAAAATGAAAAGAAGTCGG + Intronic
993099486 5:83519771-83519793 CAGATTGAACAAATAGAAGTGGG + Exonic
993736727 5:91486219-91486241 TAGAGGAAACATGAAGAAGCTGG + Intergenic
994514657 5:100755532-100755554 CAGGTTAAAGATAAAGAAGCTGG - Intergenic
994592011 5:101784918-101784940 AAAATTAAACAAAAAGAAGTTGG + Intergenic
996040032 5:118799031-118799053 CAGAGTCAAGATGAAGAAGTGGG + Intergenic
997143088 5:131403956-131403978 CAAAGTAAAAATACACAAGTTGG + Intergenic
998826513 5:146107034-146107056 CAGAGTAAATTTGTAGAAGTGGG - Intergenic
998964746 5:147527097-147527119 CAAAGGAAACAGAAAGCAGTAGG - Intergenic
1000272975 5:159704386-159704408 CAGAGTTCACATGAAGACGTGGG - Intergenic
1000371908 5:160544908-160544930 CAGAGGAAACATGGAGAAGGGGG - Intergenic
1000695742 5:164379971-164379993 CAAAGTCAACATAAAAAAATCGG - Intergenic
1000803066 5:165752445-165752467 CAGACTAAATAGATAGAAGTAGG - Intergenic
1002358924 5:178654242-178654264 AAAAGTAAAAATAAACAAGTGGG - Intergenic
1003520321 6:6853091-6853113 CAGACAATACATAAAGAAATGGG - Intergenic
1004024880 6:11808613-11808635 CAGAATATACAAAAAGAACTCGG + Intergenic
1004146084 6:13067967-13067989 CAGAGAAAACACAAAAAACTTGG - Intronic
1004419616 6:15456940-15456962 CAGAAGAAAGGTAAAGAAGTAGG + Intronic
1004804884 6:19192325-19192347 AAGAATAAACAAAAAGAATTTGG - Intergenic
1004954988 6:20719844-20719866 ATAAGGAAACATAAAGAAGTGGG - Intronic
1007014257 6:38447842-38447864 CAGGGTAAAGTTAAAGAAGCTGG + Intronic
1007900991 6:45412670-45412692 CAGAGTAAAAAAAAAAAAGTAGG - Intronic
1008334522 6:50285568-50285590 AAGAGGCAACATAAAGAAATTGG + Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1009191787 6:60638170-60638192 AAAAGTAAAAATAAATAAGTGGG + Intergenic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010062635 6:71642261-71642283 CAGAGGATAAATAAAGAAATAGG + Intergenic
1010474487 6:76269530-76269552 CAGATTAAAAAAAAAGATGTTGG + Intergenic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1011767071 6:90633543-90633565 CAGAGAACACATAAACAAATAGG - Intergenic
1011828842 6:91344514-91344536 CAGAGTAAACCTAAAGAAACAGG + Intergenic
1011900044 6:92282451-92282473 CAAAATAAACACAAAGAAATTGG - Intergenic
1011988241 6:93477659-93477681 AAGAGTAAAAATAAAGATGCAGG + Intergenic
1012429510 6:99149730-99149752 CACAGTAAAAATAAAGTATTAGG + Intergenic
1012736807 6:102958033-102958055 AAAAATAAATATAAAGAAGTGGG - Intergenic
1013597595 6:111674093-111674115 CAGTGTAATCAAAAAGCAGTGGG + Intronic
1014179453 6:118368922-118368944 CAGAGAAAACACAAACAAATGGG + Intergenic
1014916863 6:127161120-127161142 CAGAGGAAACAATAAGAGGTGGG - Intronic
1015093897 6:129391215-129391237 AAGAATTAAAATAAAGAAGTAGG - Intronic
1015392588 6:132699759-132699781 CAAAATAAACAAAATGAAGTTGG + Intronic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016679336 6:146809938-146809960 AAAAGCAAACATAAACAAGTAGG + Intronic
1016679902 6:146816871-146816893 AAAAGCAAACATAAACAAGTAGG + Intergenic
1016817210 6:148314067-148314089 GAGAGAAAACAAAAAGGAGTGGG + Intronic
1017161828 6:151372529-151372551 CAGAATAAAAATAGAGGAGTGGG + Intronic
1017308777 6:152952586-152952608 CAATAGAAACATAAAGAAGTGGG + Intergenic
1017539799 6:155389110-155389132 AAGAGAAAAAATAAAGAATTTGG + Intergenic
1017593703 6:156005742-156005764 GAGAATAAACATAAAAAAGGAGG + Intergenic
1017841468 6:158226058-158226080 CAGAGTCAAAAGATAGAAGTGGG + Intergenic
1018349823 6:162944398-162944420 CACAAGAAACATAAAAAAGTGGG + Intronic
1020356894 7:7287363-7287385 GAAAGCAAAAATAAAGAAGTGGG + Intergenic
1020762270 7:12283299-12283321 CAGAGGACACAGGAAGAAGTTGG - Intergenic
1021063404 7:16142569-16142591 CAGATTTTACTTAAAGAAGTGGG - Intronic
1021340348 7:19456839-19456861 CACAGGAAACATGAAAAAGTAGG - Intergenic
1021371006 7:19846733-19846755 CAGAGACAACATGAAGAAGATGG + Intergenic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1023101347 7:36721605-36721627 CAGAGTTAACCAGAAGAAGTTGG + Intronic
1023371147 7:39513387-39513409 CAGAATAATCATACACAAGTCGG + Intergenic
1023503719 7:40878280-40878302 CAGAGAAAACAGAAATAACTAGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024954504 7:54902449-54902471 ATGAATAATCATAAAGAAGTAGG + Intergenic
1024988459 7:55215746-55215768 CAGACAATACATAAATAAGTAGG - Intronic
1030394382 7:108967132-108967154 TAGAGTGAAAATAAAGAAGCTGG - Intergenic
1030560847 7:111083981-111084003 AAGAGTGAACAGTAAGAAGTAGG + Intronic
1031351005 7:120731003-120731025 CAGAGTAAGCATGGAGTAGTTGG + Intronic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1032616278 7:133474845-133474867 CAGATTATAGATAAAGAAATGGG - Intronic
1032807638 7:135373022-135373044 TAGAGGAAATCTAAAGAAGTTGG + Intronic
1032939268 7:136769580-136769602 CAGAGGAGACAGAAAAAAGTTGG + Intergenic
1035482002 7:159194369-159194391 CCAAGTAAACAGAAAGAGGTCGG + Intergenic
1035627712 8:1084879-1084901 CTGAGTAAACACCCAGAAGTGGG + Intergenic
1036296100 8:7539258-7539280 CTTAGTAAACATAAAGGATTGGG - Intergenic
1036326466 8:7781761-7781783 CTTAGTAAACATAAAGGATTGGG + Intergenic
1036592433 8:10181195-10181217 CAAAGTAAACTTAAAGCAGAAGG + Intronic
1037627361 8:20619800-20619822 CAGAGGAGACATAGAGAAGAAGG + Intergenic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1039516937 8:38141770-38141792 CAGTGTAAAATTAAACAAGTGGG + Intronic
1040093779 8:43422976-43422998 CAAAGTAAAAAGAAAGAACTCGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1042399499 8:68330201-68330223 TAGAGGAAACATTATGAAGTGGG + Intronic
1045091635 8:98751600-98751622 CAGAGATGACATAAAGAAATGGG + Intronic
1045495311 8:102703203-102703225 CAGAGGAAACAAAAAACAGTGGG - Intergenic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1046410665 8:113838294-113838316 CAAAGTAAACATTAAAAAATAGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1047553517 8:125903108-125903130 CACAATAAACATACAGGAGTGGG + Intergenic
1048630861 8:136240829-136240851 CAGAGCAAAGATCAAGAAGAAGG - Intergenic
1048634513 8:136281448-136281470 AAGAGAAAAAATAAAGAATTTGG + Intergenic
1050134791 9:2450744-2450766 CAAAGCAAAAATAAACAAGTGGG - Intergenic
1050155542 9:2663076-2663098 CAGGGAAAATATAAAGCAGTTGG - Intergenic
1050381026 9:5030530-5030552 CACATTAAAGATAAAGAATTTGG + Intronic
1050563673 9:6859990-6860012 AAGAGTAAAGATGAAGGAGTAGG + Intronic
1050891383 9:10828937-10828959 AATAGAAAACATAAAGAAGCAGG - Intergenic
1051526604 9:18051832-18051854 CTGAGTAGACAAAAAAAAGTAGG + Intergenic
1051817506 9:21126803-21126825 CAGAGAAGACATAAACAAATGGG + Intergenic
1052033498 9:23655097-23655119 CAGATAATACATAAACAAGTGGG - Intergenic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1052505252 9:29345018-29345040 CACAGTAAACAAAAAAAAGGGGG - Intergenic
1054968209 9:71054156-71054178 CAGATTAAAGATAAGGAACTTGG + Intronic
1056528839 9:87469140-87469162 TAGAGTAAACTTTAAGAACTAGG + Intergenic
1056967221 9:91174978-91175000 CAAAGTAAACCCAAAGAAGACGG + Intergenic
1057357588 9:94344659-94344681 CAGAGAGAAAATAAACAAGTAGG - Intergenic
1057650165 9:96912966-96912988 CAGAGAGAAAATAAACAAGTAGG + Intronic
1057735860 9:97659496-97659518 CAGAGTTGACATAATGAAATAGG - Intronic
1058350122 9:104011193-104011215 CAGAGTAAAAATAAATTAGCTGG + Intergenic
1058589743 9:106550621-106550643 CAAAAGAAACATAAAGAAGTGGG + Intergenic
1185771243 X:2767129-2767151 CTGAATCAACATAAAGAATTTGG + Intronic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186728718 X:12384767-12384789 AAGGGTAAACAAAAATAAGTAGG + Intronic
1186967295 X:14801883-14801905 CCGAGAAAACATAAACAAATGGG + Intergenic
1187539123 X:20174056-20174078 CAGACAATACATAAACAAGTGGG - Intronic
1188110234 X:26189299-26189321 CATATTAAACACAAAGAAGAAGG + Intergenic
1188794684 X:34447478-34447500 CAAAGCAAACATGAACAAGTGGG - Intergenic
1189904960 X:45748758-45748780 CAGAGCATACATACTGAAGTGGG + Intergenic
1190409410 X:50120615-50120637 AAAAGTAAAAATAAACAAGTGGG + Intergenic
1190444129 X:50505986-50506008 CTGAGTTAACATAGAGAAGTTGG + Intergenic
1190578267 X:51864002-51864024 AAAAGCAAACATAAACAAGTGGG - Intronic
1191639944 X:63419632-63419654 CATAGGTACCATAAAGAAGTTGG + Intergenic
1191722567 X:64246582-64246604 CTAAGAAAACAGAAAGAAGTAGG - Intergenic
1191976554 X:66878204-66878226 CAGAGTGAGGATACAGAAGTAGG + Intergenic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1193057681 X:77171524-77171546 CAAAGTAAAAATAAACAAATGGG + Intergenic
1193300148 X:79880064-79880086 AAGAATAAAAATAAAGAAGTAGG + Intergenic
1193436946 X:81485764-81485786 TAGATTAAAGGTAAAGAAGTGGG + Intergenic
1193650598 X:84126131-84126153 CAGACTGAAAATAAAGAAATGGG + Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196084367 X:111668474-111668496 CAAAGTAAAAATAAAGCATTTGG + Intronic
1196477053 X:116099891-116099913 CAAAGCAAACATAAACAAATGGG - Intergenic
1197588586 X:128381213-128381235 CAGAGTAAACTTAACCAAGAAGG + Intergenic
1197590667 X:128406226-128406248 CAAAGAAAATATAAATAAGTGGG + Intergenic
1197964715 X:132047061-132047083 CAAATTAAACATGAAGAATTTGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1199084556 X:143613685-143613707 CAAAGCAAAAATAAACAAGTAGG + Intergenic
1199229475 X:145419481-145419503 CAAAGCAAAAATAAACAAGTAGG - Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1200383289 X:155862394-155862416 CAAAGTCAAAATAAGGAAGTAGG - Intergenic
1202105983 Y:21366238-21366260 ACAATTAAACATAAAGAAGTAGG + Intergenic