ID: 1040483988

View in Genome Browser
Species Human (GRCh38)
Location 8:47853265-47853287
Sequence CCTTTTAGACAGTCACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040483988_1040483991 -4 Left 1040483988 8:47853265-47853287 CCAGCCAGTGACTGTCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1040483991 8:47853284-47853306 AAGGAGCCGAGTTCCCACTGAGG No data
1040483988_1040483997 28 Left 1040483988 8:47853265-47853287 CCAGCCAGTGACTGTCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1040483997 8:47853316-47853338 AGCTGGCTGCCTCAGCCCTGAGG No data
1040483988_1040483995 11 Left 1040483988 8:47853265-47853287 CCAGCCAGTGACTGTCTAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 1040483995 8:47853299-47853321 CACTGAGGCTGCCGCGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040483988 Original CRISPR CCTTTTAGACAGTCACTGGC TGG (reversed) Intronic
905467839 1:38169052-38169074 CCTGGGAGACAGTGACTGGCTGG + Intergenic
911042389 1:93600916-93600938 CCCAGTAGACAGTGACTGGCTGG + Intronic
912791280 1:112653672-112653694 CCTTTTAGACAGGCTATGCCTGG + Intronic
913387944 1:118280074-118280096 CCTTTTACAGAGCCACTGGTGGG + Intergenic
914261309 1:146001459-146001481 ACTTTTAGACAGACATGGGCGGG - Intergenic
915294946 1:154913570-154913592 CATTATAGACAGTCACATGCTGG - Intergenic
917965812 1:180177811-180177833 CCATTTGGACTGTCACTGGCTGG + Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1065788463 10:29237960-29237982 CCTTTTACACAGATACTGCCTGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067773511 10:49144607-49144629 CCATTTAGAAAGTCACTGAAAGG - Intergenic
1071390857 10:85174156-85174178 CCATTTAAAAAGTCACTGTCAGG + Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1077882155 11:6359601-6359623 ACTTTGGGACAGACACTGGCTGG + Intergenic
1078621779 11:12915032-12915054 CCTATTAGACTGTCTCTGGTTGG + Intronic
1082143371 11:48635582-48635604 CCCTGAACACAGTCACTGGCTGG - Intergenic
1082954397 11:58853558-58853580 CCTTTTAGAAAATCACGGCCAGG + Intronic
1088686314 11:112287124-112287146 CATTTTAGACAGTCGCTGATTGG - Intergenic
1088689736 11:112315548-112315570 CCTCTTACACAGTGACAGGCAGG - Intergenic
1090191449 11:124772398-124772420 CATTTTAGATAATCACTGGAAGG + Intronic
1090642828 11:128743960-128743982 CCCTGGAGACAGTCACTGACAGG - Intronic
1091204384 11:133809741-133809763 CCCTTTAGGAAGTCACTTGCTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1095390191 12:41696831-41696853 CATTTGTGACAGTGACTGGCTGG + Intergenic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1099622829 12:85025976-85025998 CCTTTTAGACATTCCATGGAAGG - Intronic
1102071617 12:110024943-110024965 CCTTTTAAATAGTGACTTGCTGG + Intronic
1102146963 12:110661434-110661456 CCTTCTAGGCAGTCACCCGCAGG - Exonic
1104259562 12:127170466-127170488 CCATATAGACACCCACTGGCTGG + Intergenic
1107400184 13:40061940-40061962 CCTTGTTAACAGGCACTGGCTGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107908380 13:45082815-45082837 CCTTGAAGACAGTCACTGCAGGG - Intergenic
1108194006 13:47973044-47973066 CTTTTAAAAGAGTCACTGGCCGG - Intronic
1110019795 13:70456089-70456111 CTTTTTAGACAGTGCCTGGTGGG - Intergenic
1115433719 14:33349855-33349877 CCTTTTGTACAGTCTCTGGGCGG + Intronic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1118570097 14:67186298-67186320 CGTGTTAGACAGTGACTGGGTGG + Intergenic
1123018966 14:105388721-105388743 CCTGTAAGACAGCCACTTGCCGG + Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1125754324 15:42052306-42052328 CCTTTTCCCCAGTCACTTGCCGG - Intergenic
1128055887 15:64699929-64699951 CCTTTTAGAAAGTTAGGGGCAGG + Intronic
1129494550 15:75965645-75965667 CCTTGTACACAGTCATTGGTAGG - Intronic
1129794321 15:78364390-78364412 CCTTTCAGACACACGCTGGCAGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131548120 15:93332891-93332913 ACTTTTAGAAAGTCATGGGCCGG + Intergenic
1133506575 16:6418234-6418256 CATTTTAGCCAGTGAGTGGCCGG + Intronic
1134776128 16:16855202-16855224 CCTTCTAGACAGGATCTGGCTGG + Intergenic
1138668092 16:58589535-58589557 TCCTATAGTCAGTCACTGGCAGG + Intronic
1139334864 16:66224662-66224684 TCTTTAAGACAGTCACAGCCGGG + Intergenic
1143295905 17:5871808-5871830 CTTATTAGACACCCACTGGCCGG + Intronic
1143451235 17:7038140-7038162 CCTTTTTGACAGGCTCTGGCTGG + Exonic
1144815656 17:18032684-18032706 CCTACTAGACAGTAAATGGCTGG - Intronic
1146575637 17:33988819-33988841 ACTCTTAGACAGTGACTGGTTGG + Intronic
1146912822 17:36659208-36659230 CCGTGTAGACTGGCACTGGCTGG - Intergenic
1147014502 17:37480528-37480550 CTTTTTAATCAGACACTGGCTGG + Intergenic
1151813867 17:76461385-76461407 CCTTACAGACAGTCAGTGGTTGG - Intronic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1157262433 18:46187635-46187657 CCTTTAAGACAGTTATTGGCCGG - Intronic
1157558877 18:48632313-48632335 CCATTTACACAGTCACACGCAGG + Intronic
1165510372 19:36263375-36263397 CCTTTTAAACAGTAAATTGCTGG + Intergenic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
925046234 2:774572-774594 CCTTTCAGACCGTCACAGGCAGG - Intergenic
928797761 2:35043563-35043585 CCTTTTAGACAGTCAATTGTTGG + Intergenic
943029820 2:182671912-182671934 CATTTTAGAAAGTCACGGCCGGG - Intergenic
947501985 2:230677547-230677569 CCTCTGAGACAGCCACAGGCAGG - Intergenic
1170713948 20:18816478-18816500 CCTCTGAGACATTCACAGGCTGG - Intronic
1176430356 21:6571561-6571583 CCTTTCCGACAGCCACAGGCAGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1177355948 21:20007706-20007728 ACTTTTAGACAGTCAATTCCTGG - Intergenic
1179705750 21:43179023-43179045 CCTTTCCGACAGCCACAGGCAGG - Intergenic
1184786488 22:46674447-46674469 CCTCTTCAACAGGCACTGGCAGG - Intronic
950064980 3:10104767-10104789 CCTTTAGGACTGTCAATGGCAGG - Exonic
958792241 3:98664818-98664840 CCTATTAGAAAGTCACGGCCGGG - Intergenic
960853328 3:122078135-122078157 CCTTTTACTCATTCTCTGGCCGG - Intronic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
966903698 3:184506654-184506676 CCTATTTGACATTAACTGGCTGG - Intronic
969607073 4:8207525-8207547 CTAATTAGACAGTCACTGCCTGG - Intronic
982173302 4:152682269-152682291 GCTTTCAGACAGCCAATGGCAGG - Intergenic
983170181 4:164527048-164527070 CCTTTGACAAAGTCACTAGCAGG + Intergenic
984995810 4:185428540-185428562 TTTTTTAGACAGTCCCAGGCTGG - Intronic
986635048 5:9812792-9812814 CCATGTGGACAGTCACTGGGTGG + Intergenic
988984653 5:36605442-36605464 CCTTTTAAACAGCTACTGGTTGG - Intergenic
992929865 5:81632358-81632380 GCATTTAGACAGTTAGTGGCAGG + Intronic
994672993 5:102784714-102784736 ACTTTGTGTCAGTCACTGGCGGG + Intronic
998097002 5:139401677-139401699 CCTTTGACACAGGCACTGGGTGG + Intronic
999653650 5:153792169-153792191 CTTTTTAGACAGTCCCTTGTTGG + Intronic
1002212658 5:177608013-177608035 CCCCTCAGCCAGTCACTGGCTGG + Intronic
1003078584 6:3003102-3003124 CCTGGTGGACAGTCACTGCCTGG - Intronic
1003084754 6:3052636-3052658 CCTGGTAGACAGTCACTGCCTGG + Intergenic
1004499847 6:16199644-16199666 CCTCTTAGAAAGTTAGTGGCAGG - Intergenic
1007256222 6:40530799-40530821 CCTGTTAGACAGTCAAGGGCAGG - Intronic
1007291722 6:40792438-40792460 CCTTTTAGGCAATCTCTAGCAGG - Intergenic
1009272291 6:61628601-61628623 CCTTTTTGACAGGCACTGTTTGG - Intergenic
1012077096 6:94703147-94703169 ACTTTTAAACAGTCTCAGGCAGG - Intergenic
1012771798 6:103447103-103447125 GCTTGTAGACAGACACTGCCTGG - Intergenic
1016863671 6:148746680-148746702 TCTTGTAAACAGTCACCGGCAGG - Intergenic
1017552620 6:155525271-155525293 ACTTTTACACACCCACTGGCAGG - Intergenic
1019732361 7:2635034-2635056 CCCTCTCGACAGTCACTGGCTGG - Intronic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023337103 7:39181672-39181694 CGTTTTAGACAGTCATTGAAAGG - Intronic
1024812592 7:53230355-53230377 CCTATTAGGCATTCACTTGCTGG - Intergenic
1026004900 7:66592681-66592703 GCTTATAGATAGTCACTGTCAGG + Intergenic
1028110962 7:86940781-86940803 TCTTCTATACAGTCTCTGGCTGG + Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1040807582 8:51410379-51410401 CATGTTAGCCAGTCCCTGGCTGG + Intronic
1052398408 9:27970281-27970303 CCCTCTTGACAGTCATTGGCTGG + Intronic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1061604438 9:131698274-131698296 CCTTGTAAACAGACACTTGCAGG + Intronic
1195024717 X:100864897-100864919 CCTTTTAGAAAGTCTTTGACAGG - Intronic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1200692761 Y:6323617-6323639 CCTCTTTGGCAGTCACTGCCTGG - Intergenic
1201042511 Y:9851109-9851131 CCTCTTTGGCAGTCACTGCCTGG + Intergenic