ID: 1040489512

View in Genome Browser
Species Human (GRCh38)
Location 8:47906590-47906612
Sequence CACTGTGTCTGGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2072
Summary {0: 1, 1: 1, 2: 20, 3: 205, 4: 1845}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040489512_1040489516 15 Left 1040489512 8:47906590-47906612 CCCACTGCACTCCAGACACAGTG 0: 1
1: 1
2: 20
3: 205
4: 1845
Right 1040489516 8:47906628-47906650 AAAAAAAAGTAAAATGCTTGTGG No data
1040489512_1040489517 18 Left 1040489512 8:47906590-47906612 CCCACTGCACTCCAGACACAGTG 0: 1
1: 1
2: 20
3: 205
4: 1845
Right 1040489517 8:47906631-47906653 AAAAAGTAAAATGCTTGTGGTGG No data
1040489512_1040489518 27 Left 1040489512 8:47906590-47906612 CCCACTGCACTCCAGACACAGTG 0: 1
1: 1
2: 20
3: 205
4: 1845
Right 1040489518 8:47906640-47906662 AATGCTTGTGGTGGAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040489512 Original CRISPR CACTGTGTCTGGAGTGCAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr