ID: 1040491317

View in Genome Browser
Species Human (GRCh38)
Location 8:47924955-47924977
Sequence GGGCGATGGAGGTAGTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491317_1040491330 28 Left 1040491317 8:47924955-47924977 CCAAACTACTACCTCCATCGCCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491317_1040491331 29 Left 1040491317 8:47924955-47924977 CCAAACTACTACCTCCATCGCCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491317 Original CRISPR GGGCGATGGAGGTAGTAGTT TGG (reversed) Intronic
901062852 1:6481114-6481136 GGGGGATGGGGGTAGCAGTGAGG - Intronic
902609908 1:17590912-17590934 GGGAGGTGGAGGTTGTAGTGAGG + Intronic
904214005 1:28905124-28905146 GGGAGATGGAGGTTGCAGTGAGG + Intronic
904470430 1:30732399-30732421 GGGTGATGGAGGTAGAAGGCTGG + Intergenic
905187703 1:36208481-36208503 GGGTGATGGAGATAGTGGTGGGG - Intergenic
907528523 1:55069798-55069820 GGGAGAAGGAGGTAGCAGTGAGG + Intronic
917563590 1:176186780-176186802 GGACTAGGGTGGTAGTAGTTGGG + Intronic
921801176 1:219404200-219404222 GGGCTTTGGAGATATTAGTTAGG - Intergenic
922981351 1:229829620-229829642 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
922981466 1:229830610-229830632 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
923548352 1:234941309-234941331 TGGAGATGGAGGTAGGGGTTGGG - Intergenic
1063701140 10:8386530-8386552 GAGGGCTGGAGGTAGAAGTTGGG + Intergenic
1067527755 10:47048554-47048576 GGGCCAAGAAGGCAGTAGTTGGG + Intergenic
1068987808 10:63123223-63123245 GGGAGGTGGAGGTTGTATTTTGG - Intergenic
1069895821 10:71679482-71679504 GGGCTATGGAGGTAGGTGTGGGG + Intronic
1073863855 10:107778233-107778255 GGGGAATGGAGGCAGGAGTTTGG + Intergenic
1080451667 11:32383270-32383292 GGGCCATGGAGGAGGCAGTTGGG - Intergenic
1080499437 11:32854483-32854505 GGGAGGTGGAGGTTGTAGTGAGG + Exonic
1083953035 11:65967305-65967327 AGGAGAAGGAGGTAGTAGTGCGG + Exonic
1091964426 12:4725964-4725986 GGATGATGGTGGTAGTGGTTAGG + Intronic
1092289512 12:7150828-7150850 AGGAGATGGGGGCAGTAGTTAGG + Intronic
1093442538 12:19215483-19215505 GGGCGTTGCATATAGTAGTTTGG + Intronic
1094540163 12:31356763-31356785 GGAAGATGGAGGTTGTAGTGAGG - Intergenic
1095463217 12:42463645-42463667 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1096449934 12:51730826-51730848 GGGAGATGGAGGTAGTTAATGGG - Intronic
1097415966 12:59317338-59317360 AGGAGGTGGAGGTAGTAGTGAGG - Intergenic
1098621673 12:72608686-72608708 TGGGGATGGAGGGAGAAGTTTGG - Intronic
1098991852 12:77072339-77072361 GGGTGATGGAGAGAGGAGTTTGG + Intergenic
1100079604 12:90832169-90832191 GGGCAAGGGAGGTAGGAGTAGGG + Intergenic
1102050682 12:109859444-109859466 GGGAGGTGGAGGTTGTAGTGAGG + Intronic
1102200011 12:111050669-111050691 TGGAGATGGAGGTAGGAGATGGG - Intronic
1102267691 12:111501962-111501984 GGGAGATGGAGGTTGCAGTGAGG - Intronic
1104913477 12:132251705-132251727 GGGGAATGGAGGTAGTGCTTGGG + Intronic
1105257583 13:18754436-18754458 GGGTGTTGGAGGTAGTGGTGTGG - Intergenic
1107792211 13:44014035-44014057 GGGCCTCGGAGGTAGAAGTTTGG - Intergenic
1117512930 14:56471398-56471420 GGGAGCTGGTGGTAGTAGCTGGG + Intergenic
1117843130 14:59881419-59881441 GGCCCATGGAGGAAGTATTTAGG - Intergenic
1119457016 14:74764214-74764236 TGGTGGTGGAGCTAGTAGTTGGG - Exonic
1125977426 15:43967303-43967325 GGGAGGTGGAGGTTGTAGTGAGG - Intronic
1126729270 15:51665540-51665562 GGGTGGTGGTGGTGGTAGTTGGG - Intergenic
1127422031 15:58815750-58815772 GGGAGATGGAGGTTGCAGTGAGG - Intronic
1130054172 15:80508088-80508110 GGGAGATGGAGGAGGGAGTTCGG - Intronic
1135380698 16:21993992-21994014 GGGCAATGGAGGTGGTGGGTGGG - Intronic
1138834046 16:60411521-60411543 GGGAGGTGGAGGTTGTAGTGAGG + Intergenic
1140785725 16:78340267-78340289 GGGAGGTGGAGGTTGCAGTTAGG - Intronic
1143398171 17:6619497-6619519 GGGAGATGGAGGTGGCAGTGAGG - Intronic
1144771932 17:17764543-17764565 GGGAGACGGAGGTTGTAGTGAGG - Intronic
1147972418 17:44226303-44226325 GGGAGATGGAGGCAGCATTTTGG - Intergenic
1152165671 17:78703589-78703611 TGGGGATGGAGGTAGAAGTAAGG - Intronic
1155416584 18:25605584-25605606 GAGCCCTGGAGGTAGTACTTTGG - Intergenic
1158009004 18:52706984-52707006 GAGGGATGGAGGTAGAAGCTGGG + Intronic
1162981059 19:14240281-14240303 GGGAGATGGAGGTAACAGTGAGG - Intergenic
1165165369 19:33850032-33850054 GAGCAATGGAGGTAGCAGTGTGG - Intergenic
1167707846 19:51092197-51092219 GGGCGAGGGAGGGAGGGGTTGGG - Intergenic
925537188 2:4930353-4930375 GGGAGGTGGAGGTTGTAGTGAGG + Intergenic
926142859 2:10378654-10378676 GGGCGATGGTGGTAGGGGGTGGG - Intronic
927545458 2:23949011-23949033 GGGAGATGGAGGTTGCAGTGAGG - Intronic
927862512 2:26568946-26568968 GGGAGATGGAGGTTGCAGTGAGG + Intronic
929428845 2:41870131-41870153 GGGTGATGGAGGCAGCAGGTGGG + Intergenic
930909324 2:56611558-56611580 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
931269697 2:60690526-60690548 GAGGGATGAAGGTATTAGTTAGG - Intergenic
931869141 2:66440653-66440675 GGGCGTTGGAGGTGGGAGGTAGG - Intronic
932246006 2:70197205-70197227 GGGAGGTGGAGGTTGTAGTGAGG - Intronic
932341417 2:70964767-70964789 AGGCCATGAAGGCAGTAGTTGGG + Exonic
935308149 2:101757950-101757972 GGGAGATGGAGGTTGCAGTGAGG + Intronic
938091742 2:128438907-128438929 GGGCGATGGAGGTCGTTCTGTGG - Intergenic
939007503 2:136806308-136806330 GGGCCATGCAGCTAGGAGTTGGG - Intronic
939927991 2:148197884-148197906 GGGAGGTGGAGGTTGCAGTTAGG - Intronic
941311708 2:163940840-163940862 GGGCCCTGGAGGTACCAGTTGGG + Intergenic
948678503 2:239613414-239613436 GGGAGATGGAGGTTGCAGTGAGG - Intergenic
948792517 2:240386306-240386328 GGGGGATGGAGGAAGAAGTTGGG + Intergenic
1173133369 20:40415688-40415710 GGGAGAGGGATGTAGTATTTAGG + Intergenic
1181714078 22:24711713-24711735 GGGAGATGGAGGTGGGTGTTTGG + Intergenic
1182530909 22:30955932-30955954 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1184268495 22:43363794-43363816 GGGAGAGGGAGGAGGTAGTTGGG - Intergenic
1184291511 22:43500086-43500108 TGGCGATGGAGGTGGTAGTGGGG + Intronic
950678446 3:14568748-14568770 GAGCGAGGGAGGAAGTAGCTAGG + Intergenic
953338310 3:42112660-42112682 GGGAGATGGAGGTTGCAGTTAGG + Intronic
964069205 3:152611490-152611512 GGGAGACTGAGGTAGGAGTTTGG - Intergenic
964830906 3:160883677-160883699 GGGCGAGGGAGAAAGAAGTTAGG + Intronic
968199376 3:196739724-196739746 GGCCGCTGGGAGTAGTAGTTCGG - Intergenic
971983878 4:33794026-33794048 GGGAGGTGGAGGCTGTAGTTAGG - Intergenic
977183351 4:93904864-93904886 GGGCCACAGAGCTAGTAGTTGGG - Intergenic
977376867 4:96216818-96216840 GTGGGAAGGAGGTAATAGTTGGG - Intergenic
978592811 4:110344279-110344301 TGGAGATGGTGGTAGAAGTTAGG + Intergenic
982955242 4:161756974-161756996 GAGAGATGGAGGTAGTGGTTAGG + Intronic
995004308 5:107172323-107172345 TGGCGGTAGAGGTAGTTGTTGGG - Intergenic
997899584 5:137753223-137753245 CGGCGGTGGAGGCAGTAGCTGGG - Exonic
1002307669 5:178293374-178293396 GTGCCATGGAGGTGGGAGTTCGG + Intronic
1006120275 6:31800261-31800283 GGGAGGTGGAGGTTGTAGTGAGG + Intronic
1007694709 6:43724904-43724926 GGGAGATGGTGGTGGTGGTTTGG + Intergenic
1009689099 6:67003530-67003552 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1009754024 6:67911800-67911822 GGGAGGTGGAGGTTGTAGTGAGG - Intergenic
1013011635 6:106125817-106125839 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1014149224 6:118034483-118034505 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1014695388 6:124614319-124614341 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1018118095 6:160607533-160607555 GGGCAAAGCAGGTAGGAGTTTGG + Intronic
1018332196 6:162741590-162741612 GGGCTTTGGGGGTAGTAATTAGG - Intronic
1025696918 7:63782380-63782402 GGGAGATGGAGGTAGGAGGATGG - Intergenic
1026687108 7:72520490-72520512 GGGAGATGGAGGCACTAGTGGGG - Intergenic
1027508930 7:79054642-79054664 TGGAGATGGAGGAATTAGTTAGG - Intronic
1031073036 7:117183351-117183373 GGGAGGTGGAGGTTGTAGTGAGG + Intronic
1037056580 8:14449583-14449605 GGACGATGGAGGGAGTAGAGGGG - Intronic
1037156250 8:15703003-15703025 GTGCAATGGAGGTAGTAGTGAGG + Intronic
1037334238 8:17776604-17776626 GGGAGGTGGAGGTTGTAGTGAGG + Intronic
1037765780 8:21771435-21771457 GGGCGAAGGAGGGAGCAGTGTGG - Intronic
1037846407 8:22286692-22286714 GGGAGATGGAGGTAGCACTGAGG - Intronic
1040491317 8:47924955-47924977 GGGCGATGGAGGTAGTAGTTTGG - Intronic
1041344171 8:56878762-56878784 GGGAGAGAGAGGTAGTAGGTGGG + Intergenic
1046105066 8:109655186-109655208 GGGAGATGGAGGTTGAAGATTGG - Intronic
1047874813 8:129124145-129124167 GGGAGATGGAGGTTGCAGTCTGG - Intergenic
1051410510 9:16785465-16785487 GGGAGGTGGAGGTTGCAGTTAGG - Intronic
1051488124 9:17630799-17630821 GGGAGTTGGAGGTAGTAGGTTGG + Intronic
1053664048 9:40305111-40305133 GGGCGTTGGAGGTAGGGGTGTGG + Intronic
1053665014 9:40311317-40311339 GGGCGTTGGAGGTAGGGGTGTGG + Intronic
1053915020 9:42939301-42939323 GGGGGTTGGAGGTAGGGGTTTGG + Intergenic
1054376582 9:64454284-64454306 GGGGGTTGGAGGTAGGGGTTTGG + Intergenic
1054519601 9:66064967-66064989 GGGCGTTGGAGGTAGGGGTGTGG - Intergenic
1054520566 9:66071174-66071196 GGGCGTTGGAGGTAGGGGTGTGG - Intergenic
1058782950 9:108357069-108357091 GGGTGATGGAGGAAGTAGCTGGG - Intergenic
1061340407 9:129975828-129975850 GGGAGGTGGAGGTTGTGGTTAGG + Intronic
1185496549 X:558302-558324 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1186514083 X:10153029-10153051 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1187447126 X:19369835-19369857 GGGAGATGGAGGTTGCAGTGAGG + Intronic
1188024102 X:25190172-25190194 GGGGGATGGTGGTGGTAGGTAGG + Intergenic
1190882245 X:54499951-54499973 GGGAGATGGAGGTTGCAGTGAGG + Intergenic
1196458226 X:115904640-115904662 GGGCCAGGGAGGTAGCAGCTTGG - Intergenic
1200613268 Y:5349053-5349075 GGGAGATGGAGGTTGCAGTGAGG + Intronic