ID: 1040491318

View in Genome Browser
Species Human (GRCh38)
Location 8:47924966-47924988
Sequence CAGGGTGAGAAGGGCGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491318_1040491331 18 Left 1040491318 8:47924966-47924988 CCTCCATCGCCCTTCTCACCCTG 0: 1
1: 1
2: 3
3: 43
4: 397
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data
1040491318_1040491330 17 Left 1040491318 8:47924966-47924988 CCTCCATCGCCCTTCTCACCCTG 0: 1
1: 1
2: 3
3: 43
4: 397
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491318_1040491334 30 Left 1040491318 8:47924966-47924988 CCTCCATCGCCCTTCTCACCCTG 0: 1
1: 1
2: 3
3: 43
4: 397
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491318 Original CRISPR CAGGGTGAGAAGGGCGATGG AGG (reversed) Intronic
900556625 1:3283972-3283994 CAGGGTTGGAAGTGCGCTGGGGG + Intronic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
903769638 1:25755779-25755801 CAGGGTGGGAAGGGGCATTGTGG + Intronic
904334450 1:29787685-29787707 CAGGGGGAGATGAGCGAGGGAGG - Intergenic
904421610 1:30398063-30398085 CAGGATGAGGAGGGCGTAGGAGG + Intergenic
904440077 1:30524508-30524530 CAGGGTGAGAAGGGGAGGGGAGG + Intergenic
904473686 1:30751148-30751170 CTGGGTGGGATGGGCCATGGGGG + Intronic
904604692 1:31692039-31692061 AAAGGCGAGAAGGGCGACGGAGG - Exonic
904789774 1:33010717-33010739 CAGGGTGAGGATGGTGAGGGAGG - Intronic
904906365 1:33900050-33900072 CAGGGTGAGAGGGGCAGGGGAGG + Intronic
905064510 1:35168779-35168801 GAGGGTGAGAAGGAAGATTGGGG + Intergenic
905933466 1:41806182-41806204 CAGGCTGAGAGGGGCCTTGGTGG - Intronic
907890295 1:58630729-58630751 CAGGGTGAGGATGGTGAGGGAGG - Intergenic
907890440 1:58631606-58631628 CATGGTGAGAAGGACAAAGGTGG - Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910655670 1:89615601-89615623 CAGGCTGTAAAGGGCCATGGGGG + Intergenic
911710538 1:101066652-101066674 CAGGATGAGAAGGGAGAGAGTGG + Intergenic
912511932 1:110195525-110195547 CAGGGTGGGCAGGGCCCTGGGGG - Intronic
912701994 1:111884898-111884920 GGGGGTGAGTATGGCGATGGGGG + Intronic
912703452 1:111895203-111895225 CAGGGTGAGGACGGAGAGGGAGG + Intronic
914196241 1:145449480-145449502 CAGGGGCAGGAGGGAGATGGAGG - Intergenic
914340393 1:146755225-146755247 GAGGGGGACAAGGGAGATGGAGG - Intergenic
915043978 1:152995654-152995676 CAGGGGGAGAAGGGAGAGTGTGG + Intergenic
915316734 1:155033036-155033058 CAGGATGAGGGGGGCGAGGGGGG + Intronic
915357826 1:155266892-155266914 GAGGCTGAGAAGAGAGATGGGGG + Exonic
916174026 1:162023219-162023241 CAGGGCAAGAAGGGCGGTCGTGG + Intronic
916217715 1:162411690-162411712 CAGGGAGAGCAGGCAGATGGAGG + Intronic
917218485 1:172702545-172702567 GAGGGTGAAAAGGGCCAGGGTGG + Intergenic
917469596 1:175315019-175315041 AAGGGGGAGCAGGGCCATGGGGG + Intergenic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
917820515 1:178758551-178758573 GAGGCTGAGAAGGGCAGTGGAGG - Intronic
919001632 1:191839190-191839212 AAGGGAGAGGAGAGCGATGGTGG + Intergenic
919823017 1:201484688-201484710 CAGGGTGTGGTGGGTGATGGTGG + Exonic
920304414 1:205009487-205009509 GATGGTGAGGAGGGAGATGGAGG - Intronic
920377557 1:205517257-205517279 GAGGGGGAGAAGGGCCAGGGAGG - Intronic
921163927 1:212492370-212492392 CAAGATGAGAAAGGAGATGGAGG + Intergenic
922193405 1:223339494-223339516 GCAGGTGAGAAGGGAGATGGCGG - Intronic
922464871 1:225839758-225839780 CAGGGAGAGAGGAGAGATGGCGG - Intronic
922681960 1:227606246-227606268 CGGGGTGAATAGGGTGATGGTGG + Intronic
924888432 1:248246078-248246100 CAGGCTGAGAAGGGTAGTGGGGG - Intergenic
1062904548 10:1170920-1170942 CAGGGTTAGGAGGGCCCTGGAGG + Intergenic
1063849887 10:10175719-10175741 CAGGGTGAGGCTGGCCATGGTGG - Intergenic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067231358 10:44413171-44413193 CAGGTTGTGCAGGGCCATGGGGG + Intergenic
1067740357 10:48890791-48890813 CAAGGTGAGAAGGGGAATAGTGG - Intronic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1069635533 10:69922705-69922727 CAGGGAGAGAAAGGCGATGCTGG + Exonic
1069879044 10:71580330-71580352 CAGGGTGAGAAGGGAGACCCAGG + Intronic
1072607017 10:96992924-96992946 CAGGGAGAGAGGGGAGAAGGAGG - Intergenic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073178254 10:101569455-101569477 CAGGATGAGAGGGGAGATGCCGG + Intergenic
1074843888 10:117379782-117379804 CAAGGAGAGAAGGGAGATGGAGG + Intergenic
1076070691 10:127486111-127486133 CAGTGTGAGAAGGGCTAGAGAGG - Intergenic
1076095109 10:127727302-127727324 GAGGCTGAGAAGGGTAATGGAGG + Intergenic
1077228672 11:1449192-1449214 CAGGCTGAGTAGGGCAGTGGTGG + Intronic
1077312130 11:1893568-1893590 GAGGGAGAGAGGGGGGATGGAGG + Intergenic
1079045693 11:17100669-17100691 GAGGGTAGGAAGGGGGATGGTGG - Intronic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1082786193 11:57318355-57318377 GAGGGAGAGAAGGAAGATGGCGG + Intronic
1082941556 11:58710398-58710420 CTAGATGAGAAGGGAGATGGTGG + Intronic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1084380919 11:68812205-68812227 CAGGGTGAGAAGAGTGGTAGTGG - Intronic
1084473642 11:69376879-69376901 GAGGGTGAGATGGGGGCTGGTGG + Intergenic
1084507826 11:69580505-69580527 CAAGGTGAGAAGGGTGATCGAGG - Intergenic
1085341215 11:75732808-75732830 CAGGGTGCTAAGGGCTGTGGTGG - Intronic
1085565111 11:77506607-77506629 CCAGGTGAGAAGGGGAATGGAGG + Intergenic
1086120422 11:83299763-83299785 CAGGGTGAGAAGGTTGTTGGTGG + Intergenic
1086260916 11:84939542-84939564 GATGGTGGGAAGGGTGATGGTGG - Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087008209 11:93489395-93489417 CAGGGAGAGAAGGGAGATGTTGG + Intronic
1087284494 11:96250125-96250147 TAGGGTGATAAGTGCCATGGAGG - Intronic
1088742988 11:112781894-112781916 AAGGATGAGAAGGAAGATGGAGG - Intergenic
1089372570 11:117971847-117971869 CAGGGTGAGGAGGGTTTTGGAGG - Intergenic
1089560287 11:119340192-119340214 CCGGGAGAGAAAGGCGAGGGCGG - Exonic
1089631697 11:119788237-119788259 TGGGGTGAGATGGGAGATGGGGG + Intergenic
1089786446 11:120910770-120910792 CAGGGTGAGAAGGACTATGATGG + Intronic
1090274218 11:125408450-125408472 CCGGGTGGGTGGGGCGATGGAGG - Intronic
1090865922 11:130700511-130700533 CAGGGTCAGAAGCGCCATGCAGG + Intronic
1091563418 12:1630755-1630777 GAGGGTGAGAAGGGCGCAGATGG + Intronic
1091915433 12:4269510-4269532 GAGGGGGAGAAGGGCGGAGGCGG + Intergenic
1095176067 12:39093334-39093356 CTGGGTGGGAAGGGTGAAGGTGG - Intergenic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1096134802 12:49190570-49190592 CAGGCTAAGAAGGGCGTGGGAGG + Intronic
1096161867 12:49385677-49385699 GAGGATGAGGAGGGTGATGGAGG + Intronic
1100569794 12:95837123-95837145 GAGGGAGAGAAGGGTGAGGGAGG + Intergenic
1101676586 12:106922438-106922460 GAGGGTGGGAAGGGCAGTGGGGG - Intergenic
1101777284 12:107806322-107806344 CAGGGAGAGAAGGGAGATCTGGG - Intergenic
1101937486 12:109069971-109069993 CAGGGCGGGGAGGGCGGTGGAGG + Intronic
1102244984 12:111349863-111349885 GCGGGTGAGATGGCCGATGGAGG + Exonic
1102624133 12:114220789-114220811 CAGGGAGATAAGGGCCAGGGAGG + Intergenic
1103875662 12:124125195-124125217 CAGGATGACAAGCGAGATGGTGG - Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1104947979 12:132425527-132425549 GAGAGAGAGAAGGGAGATGGCGG + Intergenic
1105800252 13:23896820-23896842 AAGGGTGACAAAGGCGATGCAGG - Exonic
1105848762 13:24316148-24316170 AAGGGTGACAAAGGCGATGCAGG + Exonic
1106103707 13:26716248-26716270 CAGGGTGAGAAGGGTCACGGTGG + Intergenic
1107443406 13:40448447-40448469 AAGGGTGTGAAGGGGCATGGAGG - Intergenic
1108548734 13:51522148-51522170 TAGGGGGAGAAGGGCAATGAAGG - Intergenic
1109622325 13:64925891-64925913 CAGGGTGAGAACCGCGAGGCGGG + Intergenic
1110388665 13:74945551-74945573 CAGGGAGGGGAGGGCAATGGAGG + Intergenic
1110388674 13:74945574-74945596 CAGGGAGGGGAGGGCAATGGAGG + Intergenic
1110388700 13:74945643-74945665 CAGGGAGGGGAGGGCAATGGAGG + Intergenic
1112489373 13:99848172-99848194 CAAGCTGAGAAGGGGGTTGGAGG - Intronic
1113709711 13:112455224-112455246 CAGGGAGAGAAGCTGGATGGAGG - Intergenic
1114612385 14:24051574-24051596 CAGGGCGAGTCGGGCGAGGGTGG + Intergenic
1116872943 14:50084924-50084946 CAGGGTTAGAAAGGAGATGGAGG + Intronic
1117164572 14:53020586-53020608 GGGGGTGGGAAGGGGGATGGGGG + Intergenic
1119153766 14:72389450-72389472 CTGGGTGAGAAGCGTGGTGGAGG + Intronic
1120086806 14:80284883-80284905 CCGGGTGAGAAGGGTGAATGAGG - Intronic
1122053934 14:99079489-99079511 GAGGGTGAGAAAAGGGATGGTGG - Intergenic
1122411589 14:101528646-101528668 CAGGGTGAGAAGGAAGACTGAGG + Intergenic
1122497183 14:102166106-102166128 GGGGGTGAGAAGGGGGGTGGGGG - Intronic
1122548679 14:102538728-102538750 CATGGTGGGAAGGGAGCTGGGGG - Intergenic
1122569026 14:102681741-102681763 CAGAGTGAGGATGGAGATGGGGG - Intronic
1123058605 14:105584241-105584263 GAGGGTGAGGAAGGTGATGGTGG + Intergenic
1123082936 14:105704475-105704497 GAGGGTGAGGAAGGTGATGGTGG + Intergenic
1123180690 14:106467398-106467420 CAGTGTGAGGAAGGAGATGGCGG + Intergenic
1202900740 14_GL000194v1_random:35706-35728 CAGAGTGAGAACAGAGATGGCGG + Intergenic
1202946209 14_KI270726v1_random:29260-29282 CAGTGTGAGGAAGGAGATGGCGG - Intergenic
1124351175 15:28956666-28956688 CAGGGTGAGGAGAGCTCTGGAGG - Intronic
1124381640 15:29172577-29172599 CTGGGGGAGAAGGGAGAGGGAGG + Intronic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1125612069 15:40978261-40978283 CAGGGTGAGCAAGGCTAGGGAGG + Intergenic
1127390417 15:58500755-58500777 AAGGATGAGAAGGGGGGTGGTGG - Intronic
1128737708 15:70062663-70062685 CAGAGTGGGAGGGGGGATGGGGG - Intronic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130871224 15:87973812-87973834 GAGGGGGAGAGGGGCGATGCTGG - Intronic
1131967522 15:97859906-97859928 TAGGTGGAGAAGGGGGATGGCGG - Intergenic
1132793257 16:1705734-1705756 CAGGATGAGATGGGCGTTGAGGG + Intergenic
1132875171 16:2133942-2133964 CCGGGAGAGAAGGGCGCTGGTGG - Intronic
1132892389 16:2210663-2210685 CAGGGTCAGAAGGGTCATGAGGG + Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133493416 16:6293886-6293908 CAGGGTGAGCGGGGGGGTGGTGG + Intronic
1133548087 16:6827640-6827662 AAGGGTGAGGAGGGGGAAGGAGG - Intronic
1134519816 16:14913448-14913470 CCGGGAGAGAAGGGCGCTGGTGG + Intronic
1134554115 16:15152787-15152809 CCGGGAGAGAAGGGCGCTGGTGG - Intergenic
1134691102 16:16191546-16191568 GAGGGAGAGATGGGGGATGGAGG - Intronic
1134707488 16:16312104-16312126 CCGGGAGAGAAGGGCGCTGGTGG + Intergenic
1134833402 16:17342132-17342154 AAGGGAGAGAGGGGCGGTGGAGG - Intronic
1134960055 16:18400021-18400043 CCGGGAGAGAAGGGCGCTGGTGG - Intergenic
1135826108 16:25730385-25730407 GAGGGAGAGAAGGACGAGGGAGG - Intronic
1136489005 16:30592986-30593008 GAGGTGGAGAAGGGCGAAGGGGG - Intergenic
1136576825 16:31130185-31130207 GAGGGTGGGGAGGGCGAAGGTGG + Intronic
1137314064 16:47298671-47298693 CAGGGTGGCATGGGTGATGGTGG + Intronic
1137575209 16:49595044-49595066 CAGGGTGAAAATGGCCAAGGTGG - Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1138890597 16:61139748-61139770 GAGGCTGAGAAGGGTAATGGAGG - Intergenic
1139182820 16:64767866-64767888 AAGGTTGAGTAGGGGGATGGAGG + Intergenic
1139993895 16:70962181-70962203 GAGGGGGACAAGGGAGATGGAGG + Intronic
1140291049 16:73657598-73657620 CTGGGGGAGAAAGGAGATGGGGG - Intergenic
1140506705 16:75478140-75478162 CATGGTGAGAAGGAGGATGAAGG - Exonic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141822330 16:86455153-86455175 CAGGGTGAGCAGGGCCATTGTGG - Intergenic
1141894172 16:86947842-86947864 CAGGGTGAGAAGGTGGGTGAAGG - Intergenic
1142744764 17:1950295-1950317 CAGGGTGAGGGAGGCGACGGGGG + Intronic
1143096484 17:4481039-4481061 CAGGGTGAGGAGGGTGAGGGAGG + Intronic
1143363209 17:6388056-6388078 CAGAGTGAGAAGGGGGATGTGGG + Intergenic
1143493132 17:7295090-7295112 GAGGGTGCCAAGGGCGGTGGTGG - Intergenic
1144728103 17:17511802-17511824 CGGGGTGGGAGGGGAGATGGGGG - Intronic
1145304241 17:21663975-21663997 GATGGTGAGAATGGTGATGGTGG + Intergenic
1145308125 17:21686658-21686680 CAGGGCGACAAGGGCGGTGGAGG - Intergenic
1145901763 17:28494521-28494543 CAGGCTGAGGAGGGGGCTGGGGG - Intronic
1146279010 17:31533114-31533136 CATGTTGGGAAGGGCGGTGGAGG + Exonic
1146815376 17:35937960-35937982 CTGAGTGAGAAGGGAGATGGAGG + Intronic
1147323933 17:39661466-39661488 CAGGGTGAGGAGGACGAAAGGGG - Intronic
1147419328 17:40314364-40314386 GAGGGTGAGAGGGGCTGTGGGGG + Intronic
1148346691 17:46908184-46908206 CAGAGTGAGGGGGGCGGTGGGGG - Intergenic
1148439313 17:47703403-47703425 GAGGGTGAGAAGCGTGAAGGGGG - Intronic
1149664396 17:58355608-58355630 AAGGTTGAGAAGGAAGATGGGGG + Intronic
1151315551 17:73319904-73319926 CAGGGAGCAAAGGGTGATGGGGG - Intergenic
1151584889 17:75003010-75003032 CAGGGGGAGAAGGGTGGAGGAGG + Intronic
1151658431 17:75506493-75506515 CCGGGTGAAAAGGGCAGTGGGGG + Intronic
1152238374 17:79149948-79149970 CAGGGTGGGGATGGGGATGGGGG + Intronic
1152261533 17:79269889-79269911 CAGGTGGATAAGGGCAATGGCGG - Intronic
1152460331 17:80439024-80439046 CAGGGTGTGAGGGGCGAGGCTGG - Intergenic
1152722963 17:81931783-81931805 CAGGGGGAGAGTGGCGGTGGAGG + Intergenic
1153784880 18:8525906-8525928 CAGGGAGAGAAGGGGGCTGTGGG - Intergenic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1153950488 18:10054110-10054132 CAGGGTGAGAGTGGAGATGGAGG + Intergenic
1154024001 18:10689845-10689867 CTGGGTGAGCAGGGTGGTGGGGG - Intronic
1154356439 18:13625738-13625760 CAGGGGGAGGAGGGCTCTGGTGG - Intronic
1155355139 18:24944584-24944606 CAGGGAGAGAAAGGCCATTGAGG - Intergenic
1156149604 18:34225346-34225368 GAGGGGGAGAAAGGAGATGGGGG - Intergenic
1157110294 18:44814134-44814156 CAGTGGGAGTAGGGTGATGGGGG + Intronic
1160154131 18:76420305-76420327 GAGGGTGAGAAGGACACTGGAGG - Intronic
1160744614 19:704764-704786 CAGGGTTTGAAGGGTGGTGGAGG - Intergenic
1160988426 19:1850872-1850894 CAGGGTGAGGAGGGGGAGAGAGG + Intergenic
1161154301 19:2724189-2724211 CAGGGTGAGGAGAGCGGTCGTGG - Intronic
1161236660 19:3201635-3201657 CGGGGTGGGCAGGGGGATGGGGG + Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161723788 19:5917222-5917244 CAGGGTGGGAAGGGTGTGGGTGG + Exonic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161865220 19:6828308-6828330 CAGGGTCAGCAGTACGATGGAGG + Intronic
1161998863 19:7730870-7730892 CAGGGTGAGAGGGGCGAGGGCGG + Intronic
1162007307 19:7788763-7788785 CGGGGTGAGAGGGGCGAGGGAGG - Intergenic
1162343357 19:10105676-10105698 GAGGGAGAGGAGGCCGATGGGGG + Intergenic
1162463837 19:10829425-10829447 GAGGGAGAGAAGGGGTATGGGGG + Intronic
1163497606 19:17655815-17655837 CAGGGTCAGCAGGGCTATGATGG - Intronic
1163769261 19:19180729-19180751 CAGGCTGAGGAGGGCGGGGGTGG + Exonic
1164874133 19:31671314-31671336 AAGGGTGAGAAGGTGGATGCAGG - Intergenic
1165227499 19:34365262-34365284 CCGGGTGAGAGCGGCCATGGCGG - Exonic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165449666 19:35874690-35874712 GAGGGTGAGAAGGGTCAGGGCGG + Intronic
1165852458 19:38857652-38857674 CAAGGTCAGAGGGGTGATGGGGG + Intergenic
1166121613 19:40690441-40690463 CAGCGTGAGAAGGGCGGGAGAGG - Exonic
1166219131 19:41353899-41353921 CAGGGCGCGAAGGGCGGCGGCGG + Exonic
1166278652 19:41774555-41774577 CAGGCTGAGAAGGAAGATAGAGG - Intergenic
1166383949 19:42370123-42370145 CAGGGGTAGGAGGGCGTTGGGGG - Intronic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
1166818307 19:45560495-45560517 GAGAGAGAGAAGGGAGATGGGGG - Intronic
1167128450 19:47568213-47568235 CAGGGAGAGAAGGGAGAAGGTGG - Intergenic
1167367945 19:49064625-49064647 CTGAGGGAGAAGGGCGCTGGGGG - Intronic
1167819993 19:51919015-51919037 CAATGTGAGCTGGGCGATGGTGG - Intronic
1168267424 19:55230423-55230445 CAGGGTGATGAGGGCAATGGGGG + Exonic
1168469152 19:56626962-56626984 CAGGGGAAGAAGGGCGATCAGGG - Intergenic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
925075126 2:1009862-1009884 AAGGATGAGAAGAGAGATGGGGG - Intronic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926366789 2:12140509-12140531 CAGGGTGAGATGGGCATTGCAGG + Intergenic
927503765 2:23599951-23599973 CAGAATGAAAAGGGGGATGGGGG - Intronic
927523074 2:23712947-23712969 CAGGGTGAGGCGGCCCATGGTGG - Intergenic
927648897 2:24899015-24899037 CAGGGTGACAAGGGGCATGAGGG - Intronic
927961460 2:27242846-27242868 GAGGGTGAGGAGAGCCATGGTGG - Intronic
929171143 2:38934515-38934537 GAGGGAGAGAAGGGGGAGGGAGG - Intronic
931999012 2:67866578-67866600 CAGGGTGAGAAAAGGGTTGGGGG + Intergenic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932716141 2:74101655-74101677 AAGGAGGAGAAGGGCGGTGGTGG + Exonic
932735078 2:74248657-74248679 CAGAGTGACAATGGCCATGGTGG - Intronic
935100293 2:99988178-99988200 CAGGGGGAGAAGTGCTATGAAGG + Intronic
935198074 2:100832281-100832303 CAGGGTGGGAAGGGAGATACAGG - Intronic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
937477216 2:122226395-122226417 CAGGGTGAGAAAGGCACTTGAGG + Intergenic
937612977 2:123885677-123885699 GAGGCTGAGAAGGGTAATGGGGG - Intergenic
937774667 2:125761987-125762009 CAGGGTGAGAAGGAATATGCTGG + Intergenic
937774920 2:125765011-125765033 CAGGGTTAGATGGGTGATGGAGG + Intergenic
938406512 2:131035846-131035868 CAGGGTGGGGAGGGCAGTGGCGG + Intronic
938468973 2:131542914-131542936 CAGGGTGGGGAGCGCGAAGGAGG - Intergenic
939602931 2:144216139-144216161 CAGAGAGAGAAGGCTGATGGAGG - Intronic
940551794 2:155167993-155168015 CAAGGTGAGAAGTGCTATGGTGG - Intergenic
943524774 2:189002997-189003019 CCGGGTGAGAAAGGTGAAGGAGG + Exonic
943622813 2:190168415-190168437 CAGAGTGGGGAGGGCGGTGGGGG - Intronic
944852320 2:203732612-203732634 CATGGGGAGAAGGGCAAAGGAGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946416497 2:219542803-219542825 CAGGGTGAGATGGGGGAGGGAGG - Intronic
947116077 2:226772188-226772210 AAGGGTGAAAGGGGCGTTGGTGG + Intronic
947283222 2:228479732-228479754 GAGGGTGAGAAGAGAGATTGAGG + Intergenic
948030549 2:234814169-234814191 CAGGGTGGGCAGGGCTAGGGTGG + Intergenic
948091777 2:235301715-235301737 GAGGGGGAGAAGGGGGAAGGGGG - Intergenic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
948585165 2:239014801-239014823 CAGGCTGCTAAGGGGGATGGGGG - Intergenic
948962398 2:241350130-241350152 CAGGGCGGGGATGGCGATGGCGG + Exonic
948981637 2:241497707-241497729 CAGGGTGAGCAGGGCAGTGCAGG + Intronic
1169649741 20:7853830-7853852 CAGTGTGATAAGGGCCATGAAGG + Intergenic
1171141559 20:22748097-22748119 CAGGGCGAGACAGGCTATGGTGG - Intergenic
1171455877 20:25271921-25271943 CAGGGAGTGAAGGGAGAAGGTGG - Intronic
1171555043 20:26074258-26074280 GATGGTGAGAAAGGTGATGGTGG - Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172782950 20:37447933-37447955 CAGGATGAGAGGGGAGATGCTGG - Intergenic
1172877299 20:38172760-38172782 CAGGGTGGGAGGGGATATGGGGG + Intergenic
1173167524 20:40696102-40696124 CAGGGAGAGGAGGGGGCTGGAGG - Intergenic
1173859704 20:46275179-46275201 CAGGGTGAGAGGGGCCACAGGGG - Intronic
1174299180 20:49569127-49569149 CAGGGTGGGAATGGGGATGGTGG - Intergenic
1175144596 20:56886097-56886119 GAGGGTGATAAGGGGGAAGGAGG + Intergenic
1176152266 20:63597915-63597937 CAGGGTCGGATGGGAGATGGGGG - Intronic
1176620114 21:9050484-9050506 CAGAGTGAGAACAGAGATGGCGG + Intergenic
1179344143 21:40540436-40540458 CAGTGTGAGGAGGGGCATGGAGG - Intronic
1180082560 21:45493498-45493520 CAGGGTGAGAAGGGTGAACCGGG + Exonic
1180084965 21:45504413-45504435 CAGGGGGAGAAGGGAGACCGAGG + Exonic
1180158902 21:45990375-45990397 CAGGGAGAGAAGGGCAAGCGTGG + Exonic
1180748311 22:18107474-18107496 CAGGGTGAGATGGGGGATCCAGG + Intronic
1180786907 22:18552622-18552644 AAGGGAGGGAAGGGCGATGAAGG + Intergenic
1180938878 22:19643919-19643941 CAGGGTGGGGCGGGTGATGGCGG + Intergenic
1181044852 22:20209683-20209705 CAGGGTGAGAAGGGCCCCTGTGG + Intergenic
1181234834 22:21442688-21442710 AAGGGAGGGAAGGGCGATGAAGG - Exonic
1181243816 22:21492143-21492165 AAGGGAGGGAAGGGCGATGAAGG + Intergenic
1182297136 22:29316227-29316249 CAAGGTTAGAAGGGCAGTGGGGG + Intronic
1182356361 22:29723927-29723949 CAGGTTGAGAAGGACATTGGGGG + Intronic
1182556705 22:31133232-31133254 CCGGGTGAGAGGGGCAGTGGTGG + Exonic
1182735375 22:32529310-32529332 CAGGGTGAGAAAGGAGGGGGCGG - Intronic
1183219909 22:36505970-36505992 CAGAGTGACGTGGGCGATGGTGG + Exonic
1183358029 22:37369816-37369838 CAGGGAGGGAGGGGAGATGGAGG - Exonic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183928817 22:41224678-41224700 GAGGGAGAGAAGGGAGTTGGAGG - Intronic
1184443618 22:44534369-44534391 CAGGGTGAGGAGGCAGCTGGAGG + Intergenic
1184481934 22:44752930-44752952 CAGGCTGAGAGAGGCGAGGGCGG - Intronic
1184642387 22:45879469-45879491 CAGGGAGGGAAGGGGGAGGGAGG - Intergenic
1184741041 22:46429196-46429218 CAGGATGCCGAGGGCGATGGAGG + Intronic
1185203506 22:49523128-49523150 CAGGGTGAGAAGGGTCCTGCTGG + Intronic
950658851 3:14454090-14454112 CAGGGTCAGAAGGGCCGTGTTGG + Intronic
951677806 3:25261899-25261921 GAGGTTGAGATGGGAGATGGTGG - Intronic
951715815 3:25644710-25644732 CAGGGGGTGATGGGAGATGGCGG + Intronic
952288945 3:31996497-31996519 CAGGGGGAGAAGGGGGTTAGTGG + Intronic
952754336 3:36852952-36852974 CTGGGGGAAAAGGGTGATGGAGG - Intronic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953231344 3:41067509-41067531 CAGGCTGAGAAGGGTAATGGGGG + Intergenic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953773686 3:45797817-45797839 AAGGGTGAGTAGGGTGAGGGAGG + Intergenic
954136399 3:48584042-48584064 TAGGGTGACAAAGGCGATCGTGG - Exonic
954137972 3:48590897-48590919 CAGAGTGAGAAGGGCCATGGGGG + Intronic
954453034 3:50581926-50581948 CTGGGTGGGGAGGGCGAAGGGGG + Exonic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954796159 3:53162130-53162152 TGGGGTGGGAAGGGGGATGGTGG - Intronic
957359913 3:79141533-79141555 CAGTGTGAGAGTGGCAATGGTGG + Intronic
958681727 3:97340351-97340373 CAGGGTGAGTGAGGAGATGGAGG + Intronic
959336392 3:105070565-105070587 AAGGGTGGGAAGGGTAATGGAGG + Intergenic
960056108 3:113277788-113277810 CAGGGAGAGAAGGTCTTTGGAGG + Intronic
960784598 3:121358259-121358281 GAGGGTGAGAAGGGTAGTGGGGG - Intronic
962339968 3:134574230-134574252 TGGGGTGAGAAGAGAGATGGAGG + Intronic
962886064 3:139628962-139628984 CAGGAGGAGAAAGGAGATGGTGG + Intronic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
964271735 3:154964009-154964031 CAGGGAGAGAAAGAAGATGGAGG - Intergenic
964767580 3:160193580-160193602 CAGGATGAGATGGGGGCTGGTGG + Intergenic
966099188 3:176245399-176245421 AAGGAGGAGAAGGGAGATGGTGG + Intergenic
967144718 3:186596960-186596982 CAGGGGGAGAAACGAGATGGGGG + Intronic
967856009 3:194118080-194118102 CAGTCTGAGAAGGGAGATGAGGG - Intergenic
968266957 3:197369875-197369897 CGGGGAGAGAAGGGGGAGGGGGG - Intergenic
968929947 4:3573539-3573561 CAGAGTGAGAAGGGCTATGCGGG + Intergenic
969587688 4:8104057-8104079 CAGGGAGAGAAAGGCCAGGGTGG + Intronic
969588861 4:8109875-8109897 CAGAGTGAGAAAGGCCACGGTGG - Intronic
972662443 4:41129370-41129392 CAGTGTGAGAGGGGACATGGAGG - Intronic
973659323 4:53086875-53086897 GAGGCTGGGAAGGGCAATGGGGG + Intronic
975610569 4:76198624-76198646 CAGGCAGAGAAGGGCTGTGGGGG - Intronic
976153810 4:82120791-82120813 CAGTGTGAGAAGGCCACTGGTGG + Intergenic
978262038 4:106771507-106771529 GAGGGTGTGAAGGGTGGTGGAGG + Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978450197 4:108824190-108824212 CGGGGTGAGAAGGGTGATCTAGG - Exonic
978493573 4:109334624-109334646 CGGGGTGTGAAGGCTGATGGTGG - Intergenic
978609739 4:110524276-110524298 AAGGGTGAGTAAGGAGATGGTGG + Intronic
978617431 4:110611390-110611412 AAGGGTGAGAAGGGATGTGGCGG + Intergenic
979673721 4:123387991-123388013 CATGAAGAGAAGGGCGATGCGGG - Intergenic
980113642 4:128658712-128658734 AAGGGGGAGAAGGGAGAAGGAGG + Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
984739048 4:183141283-183141305 CATGGTGAGAAAGGCCATGTGGG - Intronic
985487335 5:158792-158814 CAGAGTGGGGAGGGAGATGGAGG - Intronic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
986139948 5:5020103-5020125 CAGGATCAGAAGAGTGATGGAGG + Intergenic
987397207 5:17435910-17435932 CAGGGTGAGAAGATCTCTGGGGG + Intergenic
989279231 5:39622073-39622095 CATGGGGAGAAGGCCGAGGGAGG - Intergenic
991291561 5:65037918-65037940 AAGGGTGAGAATGGCTGTGGTGG + Intergenic
992426959 5:76667708-76667730 CAGAGTGAGAAGGGGGAGTGAGG - Intronic
992960091 5:81949495-81949517 ATGGGTGAGAAGGGGCATGGTGG - Intergenic
993013313 5:82508534-82508556 CAGGGTGAGAAGGGTGATGGAGG - Intergenic
993691346 5:91004755-91004777 CAGGGGGAGAATGGCCATGATGG + Intronic
993701907 5:91128642-91128664 CAGGGTGTGTATGGGGATGGTGG - Intronic
995012623 5:107274750-107274772 CAGGGAGAAAAGGGAGAAGGGGG + Intergenic
998104102 5:139457383-139457405 CAGGGTGAGAAGGGCTGCGGTGG - Intronic
998279035 5:140787390-140787412 CACGGTGATGAGGGCGATGACGG - Exonic
999116528 5:149169088-149169110 TAGGGTGAGACGGGGGGTGGGGG - Intronic
999231901 5:150066675-150066697 CAGGGTGGGAAGGATGTTGGGGG - Intronic
1000452420 5:161406399-161406421 AAGGTTGAGAAGGGTGATGTTGG + Intronic
1000622116 5:163497597-163497619 CAGGGTGAGAAGGATGACAGAGG + Intergenic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001121727 5:168986400-168986422 AAGGGAGAGGAGGGCTATGGAGG - Intronic
1001653514 5:173331089-173331111 CAGGGGTAGAAGTGGGATGGGGG + Intergenic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002567421 5:180119722-180119744 CAGAGGGAGGAGGGCGCTGGAGG - Intronic
1003049375 6:2765905-2765927 GAGGGTGAGGAGGGCGACGACGG + Exonic
1003512613 6:6793937-6793959 CAGGGTCAGAAGGGCCAAGGAGG - Intergenic
1003788981 6:9521263-9521285 GAGGCTGAGAATGGCTATGGGGG - Intergenic
1004619808 6:17322594-17322616 TGGGGTGACAAGGACGATGGGGG + Intergenic
1005692625 6:28322100-28322122 CAGGGTGAGTGGGGTGATGCAGG - Intergenic
1006295098 6:33166763-33166785 CAGGGAGAGAAGGGAGATCGGGG - Exonic
1006595850 6:35192185-35192207 AAGGGTGAGCAGGGCCATGTGGG - Intergenic
1007749760 6:44064664-44064686 CAGGGGAAGAAAGGCCATGGGGG + Intergenic
1007918877 6:45587846-45587868 CAGGGTGAGAGTGGGGGTGGGGG - Intronic
1011055787 6:83202122-83202144 CAGCATGAGAAGGGCTGTGGTGG - Intergenic
1011410738 6:87063323-87063345 TAGAGTGAAAAGGGAGATGGAGG + Intergenic
1012475136 6:99608746-99608768 CATGGTGAGAGGGGAGCTGGTGG + Exonic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1014191123 6:118497983-118498005 AAGGATGAGAAGGAAGATGGAGG + Intronic
1016233930 6:141838405-141838427 CAGTGTGAGAAGAACAATGGTGG - Intergenic
1016252029 6:142055011-142055033 CAGGGTGTGATGGGGGAGGGGGG + Intergenic
1017090681 6:150756087-150756109 CAGGGTGAAAAAGGTGATGTGGG - Intronic
1019049212 6:169170313-169170335 GAGGGTGGGAAGAGCAATGGGGG - Intergenic
1019102101 6:169639955-169639977 CATGGTGAGGAGGGCGAGAGGGG + Intronic
1019531486 7:1505777-1505799 CAGGGTGACAAGGCAGAGGGAGG - Intergenic
1019563974 7:1670679-1670701 CAGGGTGCGGACGGCGAAGGGGG - Intergenic
1023156426 7:37256665-37256687 GAGGGAGAGAAGGGAGAAGGAGG + Intronic
1024743962 7:52386050-52386072 CTGGGAGGGAAGGGGGATGGGGG + Intergenic
1028950213 7:96626169-96626191 GAGGCTGAGAAGGTCAATGGGGG - Intronic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1033908472 7:146235737-146235759 CACAGTGAAAAGGGCTATGGGGG + Intronic
1034203562 7:149296985-149297007 CAGGGTAAGAAGGGGGAGAGAGG - Intronic
1034399346 7:150851852-150851874 CAGGTTGAGAAGGGCGAACGTGG - Intronic
1035360532 7:158310610-158310632 CAGGCTGCGCAGGGCAATGGAGG - Intronic
1035918509 8:3651841-3651863 CATGGTGGTAAGTGCGATGGTGG - Intronic
1035923427 8:3702918-3702940 CAGGGTGAGAAAGAAAATGGGGG + Intronic
1036863425 8:12373824-12373846 CATGGTGTCAGGGGCGATGGTGG + Intergenic
1037959987 8:23090218-23090240 CATGCTGAGAAGGGCGTTGTGGG - Intronic
1038817317 8:30918154-30918176 CAGGGTGAGTGTGGCAATGGTGG + Intergenic
1039400423 8:37264440-37264462 GAGGCTGAGAAGGGCGTGGGAGG + Intergenic
1040362146 8:46676070-46676092 GAGGCTGAGAAGGGTGGTGGGGG + Intergenic
1040491318 8:47924966-47924988 CAGGGTGAGAAGGGCGATGGAGG - Intronic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040725450 8:50377129-50377151 GAGGGTGAGAAGGACAATTGAGG + Intronic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1049343660 8:142127194-142127216 CAGGGTGAGAAGGGCTTTCCTGG + Intergenic
1049381835 8:142320058-142320080 CAGGGTGAGGAGGGGACTGGTGG - Intronic
1049499667 8:142955177-142955199 CAGGCTGAGAGGGGCAATGGGGG - Intergenic
1049747417 8:144268883-144268905 GAGGGTGAGGAGGGCGCTGCAGG + Intronic
1049845855 8:144800738-144800760 TAGGGTACGAAGGGCGATGGGGG - Intronic
1050278866 9:4029600-4029622 TAGGCTGAGAAGGGTGGTGGGGG - Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1052100054 9:24435267-24435289 CAGGCTGGGAAGGGTAATGGGGG + Intergenic
1052763912 9:32620818-32620840 CATGGGGAGAAGGGGGATGAAGG - Intergenic
1053071379 9:35104060-35104082 GAGGGTGTGAAGGGGGATGGAGG - Intergenic
1054172644 9:61855715-61855737 CAGGGCTACCAGGGCGATGGAGG + Intergenic
1054460333 9:65458932-65458954 CAGAGTGAGAAGGGCTATGAGGG - Intergenic
1054664896 9:67725086-67725108 CAGGGCTACCAGGGCGATGGAGG - Intergenic
1055075739 9:72213314-72213336 CAGCCTGAGAATGGGGATGGGGG + Intronic
1055747274 9:79463121-79463143 AATTGTGAGAAGGGCTATGGTGG + Intergenic
1057181513 9:93033249-93033271 GAGGGTGAGCAGGGCCCTGGAGG + Intronic
1058882926 9:109301012-109301034 CAGGTTGAGCAGGGCTATGGTGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1060584598 9:124777953-124777975 GAGGCTCAGATGGGCGATGGCGG - Intronic
1060852113 9:126886658-126886680 TAGGGTGAGATGGGCGGTGATGG + Intergenic
1061004731 9:127922027-127922049 CAGGATGTGTAGGGCGTTGGGGG + Exonic
1061802472 9:133120090-133120112 CAGGCAGAGCAGGGCGAGGGGGG + Intronic
1062118134 9:134820158-134820180 CAGGGTGAGAAGGGCGACCGTGG + Exonic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062539887 9:137036899-137036921 CTGTGTGAGAAGGGAGCTGGTGG - Exonic
1062698491 9:137887355-137887377 CAGGGGCAGGAGGGAGATGGAGG + Intronic
1203743320 Un_GL000218v1:20939-20961 CAGAGTGAGAACAGAGATGGCGG + Intergenic
1203566786 Un_KI270744v1:98573-98595 CAGAGTGAGAACAGAGATGGCGG - Intergenic
1185478878 X:431274-431296 CAGGGTGAGAAGGTGGCTGTCGG + Intergenic
1185680588 X:1885545-1885567 CAGGCTGAGAAGGTAGATGATGG + Intergenic
1189534416 X:41922797-41922819 CAGGATGAGAAGGACGAGAGGGG + Intronic
1190031940 X:46982645-46982667 CAGGGTGAGAATGGGGGTTGAGG - Intronic
1190755944 X:53402286-53402308 AAGGGGGACAAGGGAGATGGAGG - Intronic
1192433079 X:71125744-71125766 CAGGGAGGGAAGGGAGAGGGAGG - Intronic
1193679633 X:84502301-84502323 GTGGGTGAGAAGGGCGAAGGAGG - Intronic
1196754952 X:119149912-119149934 TAGGGAGATAAGGGAGATGGGGG - Intronic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197249022 X:124195277-124195299 CAGGGTGCTAAGTGCTATGGCGG - Intronic
1198871595 X:141181394-141181416 CTGGCTAAGAAGGGGGATGGGGG - Intergenic
1201156849 Y:11138410-11138432 CAGAGTGAGAACAGAGATGGTGG + Intergenic
1201463386 Y:14253531-14253553 CAGGGTGAGATGGGAGTTGTTGG + Intergenic
1201575380 Y:15456481-15456503 AAGGGTGTGAAGGAGGATGGAGG + Intergenic