ID: 1040491319

View in Genome Browser
Species Human (GRCh38)
Location 8:47924969-47924991
Sequence AGGCAGGGTGAGAAGGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 1, 2: 3, 3: 56, 4: 682}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491319_1040491331 15 Left 1040491319 8:47924969-47924991 CCATCGCCCTTCTCACCCTGCCT 0: 1
1: 1
2: 3
3: 56
4: 682
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data
1040491319_1040491330 14 Left 1040491319 8:47924969-47924991 CCATCGCCCTTCTCACCCTGCCT 0: 1
1: 1
2: 3
3: 56
4: 682
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491319_1040491334 27 Left 1040491319 8:47924969-47924991 CCATCGCCCTTCTCACCCTGCCT 0: 1
1: 1
2: 3
3: 56
4: 682
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491319 Original CRISPR AGGCAGGGTGAGAAGGGCGA TGG (reversed) Intronic
900304930 1:2001034-2001056 TGGCTGGGTGAGGAGGGTGAGGG + Intronic
900569540 1:3351567-3351589 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
900675959 1:3886402-3886424 AGGAAGGGTGAGGAGGGGCACGG - Intergenic
901073228 1:6534442-6534464 TGACAGGGTCAGAAGGGAGATGG + Intronic
901158537 1:7156860-7156882 AGCCAGGGTGAGTATGGCGGTGG - Intronic
901452173 1:9342562-9342584 AGGCAGGATGAGGCGGGAGAGGG - Intronic
901502308 1:9660585-9660607 AAGAAGGGTGGGAAGGACGATGG - Intronic
901749994 1:11400237-11400259 AGCCTGGGTGAGGAGGGGGAGGG + Intergenic
902436392 1:16400686-16400708 GGGCAGGGTGGGATGGGCTAGGG - Intronic
903306177 1:22414769-22414791 AGGCAGCTTGAGAAGGGTGGAGG - Intergenic
903656122 1:24949803-24949825 AAGCAGGGTGCCAAGGGCCAAGG - Intronic
904334451 1:29787688-29787710 AGACAGGGGGAGATGAGCGAGGG - Intergenic
904622582 1:31784097-31784119 AGGTAGGATGAGAAGGGAGGTGG + Intergenic
904834079 1:33323777-33323799 AGGCAGGGCAGAAAGGGCGAGGG - Exonic
904854742 1:33489314-33489336 AGGCTGGGGGTGAAGGGCAAAGG - Intronic
905649782 1:39648433-39648455 AAGGAGAGTGAGAAGGGAGATGG + Intergenic
906454563 1:45982598-45982620 AGGCAGGGTGAGGTGTGGGAGGG - Intronic
906536087 1:46551688-46551710 AGGCAGGGTGAGGGGGGAGTTGG + Intergenic
906645054 1:47468933-47468955 AGGGAGGGTGAGATGGGTGGGGG - Intergenic
907275864 1:53316302-53316324 AGGCAGGCTGGGAATGGGGAGGG + Intronic
907481007 1:54745507-54745529 AGGCAGGGCCAGGAGGGCAAAGG + Intergenic
907517643 1:55002770-55002792 AGTGAGGGTGAGAATGGTGATGG + Intronic
909959867 1:81826666-81826688 AGCCAGGATGGGAAGGGTGAAGG + Intronic
910160930 1:84271423-84271445 AGACAGGGTCAGAAAGGTGATGG + Intergenic
910480969 1:87658026-87658048 AAGTAGGGTGAGAAGGTGGATGG - Intergenic
910952905 1:92670485-92670507 ACGAAGGGAGAGAAGGGCAAGGG - Intronic
911044402 1:93616862-93616884 AGGCAGCCAGAGAAGGGCGGTGG - Intronic
911410953 1:97505892-97505914 GGGCAGGATGAAAAGGGCAATGG + Intronic
912240873 1:107906795-107906817 AAGCAGGGTGAGAAGGAAGAAGG + Intronic
912335653 1:108859944-108859966 AGGCAGGGGGAGGAGGGCGGAGG - Intronic
912375096 1:109203435-109203457 AGGCTGGGTGAGGAGGGTGTCGG + Intronic
912514943 1:110211416-110211438 AGGCAGCGTCAGACGGGGGAGGG - Intronic
912561202 1:110552860-110552882 AGGTAGAGTGAGAAGTGCTAGGG + Intergenic
912703451 1:111895200-111895222 AGGCAGGGTGAGGACGGAGAGGG + Intronic
913091729 1:115480703-115480725 CGGCAGGGTGACAAGGAAGAAGG - Intergenic
913571063 1:120120488-120120510 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
913601059 1:120421471-120421493 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
913963680 1:143357563-143357585 GGGGAGGGTGGGAAGGGGGAAGG - Intergenic
914058039 1:144183152-144183174 GGGGAGGGTGGGAAGGGGGAAGG - Intergenic
914121106 1:144783213-144783235 GGGGAGGGTGGGAAGGGGGAAGG + Intergenic
914291873 1:146281466-146281488 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
914374764 1:147062956-147062978 AGGGAGGGAGAGAAGAACGAAGG - Intergenic
914552917 1:148732249-148732271 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
914901037 1:151711304-151711326 ATCCAGGGTGAGAAGGGGCAGGG - Intronic
915316731 1:155033033-155033055 ATGCAGGATGAGGGGGGCGAGGG + Intronic
915936335 1:160092246-160092268 AGGCAGAGTGAGGAGGGTGGAGG + Intronic
916073343 1:161185044-161185066 AGGCAGGGGGGGAGGGGGGAGGG + Exonic
916119283 1:161513336-161513358 AGGGAGGGAGGGAAGGGGGAAGG - Intronic
916129045 1:161594995-161595017 AGGGAGGGAGGGAAGGGGGAAGG - Intronic
916490806 1:165300808-165300830 AGGCAGGGTGAGAAGGGGGAAGG - Intronic
917554352 1:176068219-176068241 AGGCAGGGAGAGAAGGAAGAAGG - Intronic
917791001 1:178498798-178498820 GGGAAGGGTGAGAAGGGGTAGGG - Intergenic
917817534 1:178725599-178725621 AGGCTGAGGGAGAAGGGCGCTGG + Intronic
919784841 1:201252473-201252495 AGGCAGGGAGAGAAGTCTGAAGG + Intergenic
920120145 1:203650303-203650325 GGGCAGGGTGAGAACTGGGAGGG + Intronic
920259283 1:204677975-204677997 TGGCAGGGTGAGAGGAGAGAAGG - Intronic
920654629 1:207866638-207866660 GGGCAGGGTGAGCAGAGCGTGGG - Intergenic
920663803 1:207943421-207943443 AAAAAGGGTGAGAAGGGGGATGG + Intergenic
921257730 1:213357390-213357412 AGGAAGGGTGAGAGGGGGTAAGG + Intergenic
921378096 1:214494779-214494801 TGGAAGGGAGAGAAGGGGGAAGG + Intronic
921827417 1:219688685-219688707 AGGCATGGTGAGGAGAGGGAGGG - Intronic
922742307 1:228020835-228020857 AGGGAGGGTGACTAGGGAGAGGG + Intronic
922866697 1:228866689-228866711 AAGCAGGGTCAGAAGGGTAAGGG - Intergenic
923145708 1:231196240-231196262 AAGCAGAGTCAGAAGGGCCAGGG - Intronic
923655585 1:235913118-235913140 GCGCAGGGTGAGAAGGGCCTGGG + Intergenic
1062824447 10:557742-557764 AGGATGGGTGGGAAGGGGGAGGG + Intronic
1063195238 10:3735468-3735490 AGGCAGGGCGAGCAGGGGGCGGG - Intergenic
1063482335 10:6386638-6386660 AGGCTGGGTGAGGAAGGGGAAGG - Intergenic
1064121405 10:12623032-12623054 AGGGAGGGAGGGAAGGGCGAAGG - Intronic
1064746905 10:18487478-18487500 AGTCAGGGTGGGAAGGGAGGTGG + Intronic
1065506336 10:26433629-26433651 AGGCAGAGGGAGAAGAGCGGGGG - Intergenic
1065609045 10:27452675-27452697 AGGCAGGGTGAGAGTGGGGATGG - Intergenic
1066389551 10:34967793-34967815 AGACAGGGTGAGAAGGAGGGAGG + Intergenic
1066453292 10:35550508-35550530 GGCCAGGGAGAGAAGGGCAAGGG - Intronic
1067426990 10:46217870-46217892 AGGCAGGCTGAGCAGGGTGGAGG - Intergenic
1067558284 10:47287219-47287241 AGGGTGGGTGAGAAGAGGGAGGG + Intergenic
1068628030 10:59270517-59270539 AGGAAGGGAGAGAAGGGAGTAGG + Intronic
1069612195 10:69781605-69781627 AGGCAGGGTGAGTCTGGCTAGGG + Intergenic
1069685061 10:70312642-70312664 TGGCAGGGTGAACAGGGCCAGGG + Intronic
1069777192 10:70934023-70934045 AGGCAGGGGGAGAAGGGGAAGGG + Intergenic
1070721340 10:78759399-78759421 AGGGAGGGGGAGAAGGGAAAGGG + Intergenic
1070753423 10:78977114-78977136 TGGCAGAGGGAGAAGGGTGAAGG - Intergenic
1071572816 10:86707474-86707496 AGGCCAGGGGAGAAGAGCGAAGG + Intronic
1072275279 10:93816701-93816723 AGGTAGGGAGAGAAGGAGGAAGG + Intergenic
1072607018 10:96992927-96992949 AGACAGGGAGAGAGGGGAGAAGG - Intergenic
1073112116 10:101068689-101068711 AGGGAGGGTGAGAAGGAAGGGGG + Intergenic
1073267203 10:102234888-102234910 AGGCAGGGTGAGAAGGGATATGG + Intronic
1073321071 10:102616573-102616595 AGGCAGCCTGAGAAGGCAGAGGG + Intronic
1073592788 10:104772301-104772323 TGGGAGTGTGAGAAGGGCCAGGG - Intronic
1074109304 10:110411149-110411171 AGGCAGAGAGAGAAGGGCGCTGG - Intergenic
1074900848 10:117815450-117815472 AGGGAGGCTCAGAAGGGCTAAGG + Intergenic
1075656238 10:124162994-124163016 AGGGAGGGAGGGAAGGGGGAAGG + Intergenic
1075726431 10:124613096-124613118 GGGCAGGGGGAGGAGGGGGATGG + Intronic
1076365156 10:129916820-129916842 AGGCACAGTGAGCAGGACGAAGG + Intronic
1076787791 10:132759700-132759722 CTGCAGGGTGAGGAGGGCGCCGG - Intronic
1076948500 10:133666767-133666789 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076951458 10:133676675-133676697 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076952448 10:133679985-133680007 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076955404 10:133742946-133742968 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076956394 10:133746256-133746278 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076957382 10:133749565-133749587 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1076959355 10:133756174-133756196 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
1077092512 11:786114-786136 AGGCAGGCTGAGGATGGTGAGGG + Intergenic
1077537014 11:3129280-3129302 AGGCAGGGTGAGGAGGGCCTGGG + Intronic
1077548291 11:3186531-3186553 AGGGAGGGTGGGAGGGGCAAGGG - Intergenic
1077870766 11:6259814-6259836 GGGCAGGGAGAGGAGGGCGGCGG + Exonic
1077881965 11:6357991-6358013 CGGCAGGGGGAGCAGGGCAAGGG - Intergenic
1078083060 11:8217858-8217880 AGGCAGGGAGAGGTGGGCCAAGG - Intergenic
1078587081 11:12601149-12601171 AGGCAAGGGGAGAAGGCAGAGGG - Intergenic
1079087131 11:17454518-17454540 AGGCAGAGGGAGGAGGTCGAAGG + Intronic
1079489577 11:20972541-20972563 AGGGAGGCTGAGAAGGGAGGAGG + Intronic
1080853593 11:36092519-36092541 GGGAAGGGTGAGCAGGGGGAAGG - Intronic
1080854208 11:36097601-36097623 TGGAAGGGTGAGTAGGGGGAAGG + Intronic
1081621158 11:44619907-44619929 AGGCAGTGGGAGAGGGGAGAGGG + Exonic
1081831752 11:46120831-46120853 AGGCAGAGGGGGAAGGGGGAGGG + Intronic
1083154061 11:60811573-60811595 AGGAAGGATGAGGAGGGGGATGG - Intergenic
1083267448 11:61553362-61553384 AAGAAGGAAGAGAAGGGCGAGGG - Intronic
1083476872 11:62920858-62920880 GGGCAGAGTGGGAAGGGCAAAGG - Intronic
1083596206 11:63919252-63919274 GTGCAGGGTTAGAAGGGGGAGGG + Intergenic
1083675313 11:64321868-64321890 AGACTGGGTGAGAATGGTGAGGG + Intergenic
1084008237 11:66334277-66334299 AGGCAAGGGGAGAAGGGAGCAGG + Intronic
1084090389 11:66875676-66875698 AGGCAGGGTAAGATGGGGGCTGG + Intronic
1084190217 11:67495299-67495321 AGGCTGGGTGAAAAGGGGGGAGG - Intronic
1085217720 11:74847328-74847350 AGGCAGGGAGATCAGGGAGAGGG + Intronic
1085408446 11:76277807-76277829 AGGCAGGGTCAGCAGGGCTGTGG - Intergenic
1085460002 11:76687871-76687893 AGACAGGGTGGGCAGGGTGAGGG + Intergenic
1085754215 11:79190820-79190842 AGGGAGAGGGAGAAGGGAGAGGG - Intronic
1086120421 11:83299760-83299782 ATGCAGGGTGAGAAGGTTGTTGG + Intergenic
1089148171 11:116345523-116345545 AGGCAGGGTGTGCAGTGAGAGGG - Intergenic
1089755438 11:120682749-120682771 AGGCAGTGTGAGCATGGGGAAGG - Intronic
1091007397 11:131965924-131965946 AGGGAGGGAGGGAAGGGGGAAGG + Intronic
1091007411 11:131965956-131965978 AGGGAGGGAGGGAAGGGGGAAGG + Intronic
1091019923 11:132090285-132090307 AGGGAAGGTGTGAAGGGCCAAGG - Intronic
1091028252 11:132160867-132160889 AGGCAGTGAGAGAAGGAGGAGGG + Intronic
1091445475 12:542344-542366 AGGCAGGGAGAGGAGGGGGCAGG - Intronic
1091759524 12:3077593-3077615 AGGCAGTGTGGGCAGGGCGGCGG + Intronic
1092030341 12:5278556-5278578 TGGCAGGGTGAGGAGGGAGGGGG - Intergenic
1092181745 12:6451207-6451229 GGGCAGGGGGAGACGGGAGAAGG - Intronic
1092458489 12:8665985-8666007 AGGCAGGGAGGGCAGGGAGAGGG + Intergenic
1092911998 12:13153744-13153766 AGGAAGGGAGAGAAGGGAGGGGG - Intergenic
1093547703 12:20368451-20368473 AGGGAGGGTGAGAAGGGAGAAGG - Intergenic
1095176068 12:39093337-39093359 ATGCTGGGTGGGAAGGGTGAAGG - Intergenic
1095962910 12:47846527-47846549 CAACAGGGAGAGAAGGGCGAGGG - Intronic
1096134801 12:49190567-49190589 TGGCAGGCTAAGAAGGGCGTGGG + Intronic
1096657063 12:53098337-53098359 AGGCAGGGGGAGAAATGGGAGGG + Intronic
1096748924 12:53746568-53746590 AGGGAGGCTGAGGAGGGCGATGG + Intergenic
1096973385 12:55684813-55684835 GGGTAGGGTGAGAAGGGCAGGGG - Exonic
1097124934 12:56766526-56766548 AGGCAGTGTGAGAAAGAGGAGGG + Intronic
1097323692 12:58252507-58252529 AGGCAGGGAGGGAAGGAGGAGGG - Intergenic
1097535409 12:60863672-60863694 AGGCAGGAAGAGTAGGGTGATGG + Intergenic
1098887952 12:75979271-75979293 AGCCAGAGTGAGAAGTGGGATGG - Intergenic
1099034539 12:77569375-77569397 AGGGAGGGAGAGGAGGGAGATGG - Intergenic
1099182440 12:79483892-79483914 AGGGAGCGTGAGAAGTGTGAAGG - Intergenic
1099894790 12:88631705-88631727 AGGCAGGGTAAGAAGTCCCATGG + Intergenic
1100012453 12:89969877-89969899 ATTCAGGGTGAGAAGGGAGAAGG + Intergenic
1100473322 12:94913281-94913303 AGGCAGGTAGAGGAGGGCAAAGG - Intronic
1100685906 12:96985745-96985767 AAGGAGGGGGAGAGGGGCGAGGG + Intergenic
1102292154 12:111709890-111709912 AGGCAGGTTGAGAAAAGAGATGG + Intronic
1102432905 12:112897548-112897570 AGGCAGGGAGAGAAAGGAGAGGG - Exonic
1102624131 12:114220786-114220808 AGCCAGGGAGATAAGGGCCAGGG + Intergenic
1102877427 12:116458969-116458991 AGGCAGGGTGGGAAGACCAAGGG - Intergenic
1103193359 12:119021124-119021146 AGTGAGTGTGAGAAGGGTGAGGG + Intronic
1103218556 12:119223751-119223773 GGGCAGGGAGAGGAGGGTGAGGG - Intergenic
1103443814 12:120981150-120981172 AGCCAGGGAGAGAGGGGCGGGGG + Intronic
1103573037 12:121857503-121857525 AGGCAGGCTGAGGGGGGCCAGGG - Intronic
1103921585 12:124402210-124402232 AGGGAGGAGGAGTAGGGCGATGG + Intronic
1104222014 12:126794283-126794305 AGGCAGGGGAGGAAGGGAGAGGG - Intergenic
1104258622 12:127162381-127162403 ATGGAGGGTGACAAGGGAGAAGG - Intergenic
1104321680 12:127757327-127757349 AGGCTGGGTCAGAAGGAAGATGG + Intergenic
1104372410 12:128235454-128235476 AGGTAGGGAGAGAAGGACAACGG + Intergenic
1104414820 12:128589384-128589406 AGGCGGGGTGAGAGGGACGGTGG - Intronic
1104668820 12:130666861-130666883 AGGGAGGGAGAGAAGGAAGAAGG + Intronic
1104724415 12:131067004-131067026 GGGCAGGGTGAGCAGGTAGACGG + Intronic
1104947978 12:132425524-132425546 AGGGAGAGAGAGAAGGGAGATGG + Intergenic
1105509262 13:21037787-21037809 AGGCAGAGTGGGCAGGGCCAGGG + Intronic
1106103706 13:26716245-26716267 GAGCAGGGTGAGAAGGGTCACGG + Intergenic
1107443407 13:40448450-40448472 AGGAAGGGTGTGAAGGGGCATGG - Intergenic
1107708201 13:43127603-43127625 AGGGAGAGGGAGGAGGGCGAAGG - Intergenic
1107779173 13:43879747-43879769 AGGCGGGGCGAGGTGGGCGAGGG + Intronic
1108385229 13:49893622-49893644 AGGCAAGGTGAGCAGGGTTAAGG + Intergenic
1108590389 13:51907574-51907596 AGGCAAGGTGAGCAGGGTTAAGG - Intergenic
1108682334 13:52790769-52790791 GGGCAGGGGGAAAAGGGAGATGG - Intergenic
1109176522 13:59164295-59164317 AGCCAGGGTGAAAAGGAAGATGG + Intergenic
1110388664 13:74945548-74945570 AGGCAGGGAGGGGAGGGCAATGG + Intergenic
1110388673 13:74945571-74945593 AGGCAGGGAGGGGAGGGCAATGG + Intergenic
1110388682 13:74945594-74945616 AGGCAGGGAGGGGAGGGCAACGG + Intergenic
1110388699 13:74945640-74945662 AGGCAGGGAGGGGAGGGCAATGG + Intergenic
1110388715 13:74945685-74945707 AGGCAGGGAGGGGAGGGCAACGG + Intergenic
1111710385 13:91805054-91805076 AGGCAGGGGGAGATGTGTGAAGG - Intronic
1111955929 13:94758478-94758500 AGGCAGAGTGGGGAGGACGAAGG - Intergenic
1112300418 13:98224739-98224761 AGGCAGTGAGAGAAGAGCCAGGG + Intronic
1112908998 13:104458888-104458910 AGGCAGGGTGAGATGAGCAAGGG - Intergenic
1113127662 13:106998104-106998126 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1113431583 13:110255669-110255691 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113431611 13:110255734-110255756 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113431619 13:110255754-110255776 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113431627 13:110255774-110255796 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113431635 13:110255794-110255816 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113431643 13:110255814-110255836 AGGCAGGAAGGGAAGGGGGAAGG + Intronic
1113560120 13:111272174-111272196 AAGGAGGGTGAGAAGCGGGAAGG + Intronic
1113634774 13:111912126-111912148 AGGCAGGGTTAGTTGGGTGAAGG - Intergenic
1113665238 13:112136639-112136661 AGGGAGGGAGAGAAGGAAGAAGG - Intergenic
1113909695 13:113836284-113836306 GGGGAGGGGGAGAAGGGGGAGGG + Intronic
1114532315 14:23403655-23403677 AGGCAGGGAGAGAAGGCAGAGGG + Intronic
1114612384 14:24051571-24051593 AGGCAGGGCGAGTCGGGCGAGGG + Intergenic
1116264596 14:42671488-42671510 AGGCAGGGAGAGAAGGAGGGAGG - Intergenic
1118350242 14:64968456-64968478 AGGCAGCCGGAGAATGGCGATGG - Intronic
1119067417 14:71542685-71542707 AGGGAGGAGGAGAAGGGAGAAGG - Intronic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1119235401 14:73015307-73015329 AGGGAGGGAGGGAAGGGGGAAGG + Intronic
1119391804 14:74295991-74296013 AGAGAGGGAGAGAAGGGAGAGGG + Intronic
1119662733 14:76463175-76463197 ACGCAGGGAGAGAAAGGAGAGGG - Intronic
1120414941 14:84207483-84207505 AGGAAGGGAGAAAAGGGGGAAGG - Intergenic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1120793540 14:88607559-88607581 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793624 14:88607931-88607953 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793631 14:88607961-88607983 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793638 14:88607987-88608009 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793651 14:88608043-88608065 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793658 14:88608069-88608091 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793674 14:88608145-88608167 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793681 14:88608171-88608193 TTGCAGGGTGAGATGGGGGATGG - Intronic
1120793707 14:88608285-88608307 TTGCAGGGTGAGATGGGGGATGG - Intronic
1121153329 14:91658404-91658426 ATGTAGGGGGAGAATGGCGATGG + Intronic
1121378065 14:93431540-93431562 AAGAAGGGAGAGAAGGGGGAGGG + Intronic
1121529051 14:94639925-94639947 AGGCAGGGTGAGGGTGGCAAGGG + Intergenic
1121599867 14:95195398-95195420 AGGCAGGGGGAGGAGGGCCAAGG - Intronic
1121738340 14:96234389-96234411 AGGGAGGGTGAGAGGGAGGATGG - Intronic
1122030139 14:98906133-98906155 GGGCAGTGTGAGAAGGGCCCTGG - Intergenic
1122321638 14:100859085-100859107 AGGCAGGGTGTAAAGGGCCAGGG - Intergenic
1122541809 14:102502220-102502242 AGAAAGGGAGAGAAGGGGGAGGG + Exonic
1122931896 14:104936977-104936999 AGGCAGTGTGGGATGGGAGATGG - Exonic
1123067767 14:105627005-105627027 ATGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123071786 14:105645730-105645752 ACGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123091450 14:105744006-105744028 ATGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123097220 14:105772347-105772369 ACGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123438489 15:20272869-20272891 AGGAAGGCTGGGCAGGGCGAGGG + Intergenic
1123757244 15:23406615-23406637 AGGGAGGGAGGGAAGGGGGAAGG - Intergenic
1124391222 15:29259636-29259658 AGGGAGGGTGAGCAGGGTGTAGG - Intronic
1124664401 15:31580105-31580127 CAGCAGGGTGAGCAGGGAGAGGG + Intronic
1124866678 15:33499187-33499209 AGGCAGGGAGAGGAAGGGGAGGG - Intronic
1125609122 15:40958935-40958957 GGGCAGGGTGAGGAGAGCCAGGG + Intergenic
1127814133 15:62591768-62591790 AGGCTGGGTGTGGAGGTCGAGGG + Intronic
1128304138 15:66586997-66587019 GGGGAGGGGGAGAAGGGGGAAGG - Intronic
1128682044 15:69659550-69659572 AGGCAGGCTGGGAAGGGAAAAGG - Intergenic
1128875317 15:71196833-71196855 AGGCAGGGAGAGGAGGAAGATGG + Intronic
1129223805 15:74153623-74153645 AGGCAGGGTGGAAAGGAAGAGGG + Intergenic
1129330371 15:74824052-74824074 AGACAGGGTGAGCAGGGTGAGGG - Intronic
1129454147 15:75667555-75667577 AGGCAGGGTGGGAGGTGGGAAGG - Intergenic
1129603659 15:77014368-77014390 AAACAGGCTGAGAAGGGCCAGGG + Intronic
1129709601 15:77813878-77813900 GGGCAGGGTGGGGAGGGCGCTGG - Intronic
1129741153 15:77990207-77990229 AGGTAGGGTGGGGAGGGTGATGG + Intronic
1129742871 15:77998444-77998466 GGGCAGGGTGGGAAGAGCGCTGG + Intronic
1129803669 15:78436923-78436945 AGGAAGTGTGAGATGGGCCAGGG + Intergenic
1130064640 15:80593774-80593796 CGGCAGGGCAAGCAGGGCGAGGG - Exonic
1130104690 15:80920487-80920509 AGGCAAACTGAGAAGGGAGAAGG - Intronic
1130120672 15:81045020-81045042 AGGCAAAGAGAGAAGGGAGATGG - Intronic
1130705881 15:86232563-86232585 AGGCAGGGTGAGCAGAGCCAGGG + Intronic
1131055064 15:89370211-89370233 AGGCAGGGAGTGCAGGGCAAGGG - Intergenic
1131229217 15:90647612-90647634 AGGAGGGGTGTGAAGGGGGAGGG - Intergenic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1132664633 16:1075973-1075995 AGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1132760781 16:1507633-1507655 AGGCAGGCTGAGCAGGACGGAGG - Exonic
1132783617 16:1642238-1642260 AGCCTGGGGGAGAAGGGCCAAGG - Intronic
1133417296 16:5616569-5616591 AGGGAGAGGGAGAAGGGAGAGGG - Intergenic
1133507476 16:6426296-6426318 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1133561658 16:6956173-6956195 AGGAAGGATGAGAATGGAGATGG + Intronic
1133680237 16:8114389-8114411 AGGGAGTGGGAGAGGGGCGAGGG - Intergenic
1135533908 16:23277999-23278021 AGGCAGGGTGGGGAGGGAGGGGG + Intergenic
1135826109 16:25730388-25730410 AGAGAGGGAGAGAAGGACGAGGG - Intronic
1136114872 16:28088135-28088157 GGCCTGGCTGAGAAGGGCGAGGG + Intergenic
1136254649 16:29029906-29029928 AGGGGTGGTGAGAAGGGCCAAGG + Intergenic
1136576824 16:31130182-31130204 GGGGAGGGTGGGGAGGGCGAAGG + Intronic
1137977256 16:53042279-53042301 AGGAAGGGAGAGAAAGGAGAGGG - Intergenic
1138480814 16:57301992-57302014 AGGCATGGAGCGAAGGGAGAAGG + Intergenic
1138828564 16:60351375-60351397 TGGCAGGGTGAGGATGGGGAGGG + Intergenic
1138936593 16:61733665-61733687 AGGAAGGGTGGGAAGGGCACTGG - Intronic
1139004116 16:62550427-62550449 AGGGAGGGTGAGAGGGAGGAAGG - Intergenic
1139371165 16:66470257-66470279 TGGATGGGTGAGAAGGGAGAAGG + Intronic
1140194650 16:72846387-72846409 AAGCAGGGAGAGAAGGGACAAGG + Intronic
1141088075 16:81110797-81110819 AGCCAGGGTGAGGATGGGGAAGG + Intergenic
1141344774 16:83234458-83234480 ACGCAGGGTCAGTAGGGAGAGGG + Intronic
1141374464 16:83517594-83517616 AGGGAGGGTGAGAAATGTGAGGG + Intronic
1141427142 16:83951887-83951909 AAGCAGGGAGAGAAGGAGGAAGG - Intronic
1141540080 16:84713395-84713417 AGACAGGGTGACAAGTGTGAAGG - Intronic
1141573655 16:84950402-84950424 AGGCAGGGGGTGAAGGGTGATGG - Intergenic
1141855967 16:86681757-86681779 AGGGAGGGAGAGATGGGAGAAGG + Intergenic
1142319615 16:89372467-89372489 AGTCACTGTGAGAAGAGCGAAGG + Intronic
1142365330 16:89647014-89647036 AGGTAGGGTGGGCAGGGCGGCGG - Intronic
1142560081 17:804607-804629 AGACTGGGTGAGATGGGAGACGG + Intronic
1142801984 17:2352064-2352086 AGACAAGGTGAGAGGAGCGAAGG - Intronic
1142907172 17:3051704-3051726 ATGCTGGCTGGGAAGGGCGAGGG + Intergenic
1142927396 17:3252552-3252574 ATGCTGGCTGGGAAGGGCGAGGG - Intergenic
1143096483 17:4481036-4481058 GAGCAGGGTGAGGAGGGTGAGGG + Intronic
1143621639 17:8084319-8084341 AGGCAGGTGGAGGAGGGAGAGGG - Intronic
1144300511 17:13919335-13919357 AGGAAGAGTGAGAAGGGGAAGGG - Intergenic
1144439500 17:15268803-15268825 AGGCAGGGAAAGAAGGCAGAGGG + Intergenic
1144731543 17:17529014-17529036 AGCCCTGGTGAGAAGGGAGAGGG - Intronic
1144763046 17:17718121-17718143 AAGCAGGGGGAGAGGGGAGAGGG - Intronic
1144789272 17:17848359-17848381 AGGCAGGATGTGAAGGGCAGGGG + Intronic
1145286898 17:21512568-21512590 AGGCGAGGAGAGAAGGGCGTCGG + Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1145825528 17:27874515-27874537 ATGCAGTGTGAGAAGTGCTAGGG - Intronic
1145885654 17:28380980-28381002 AGGGAGGGGGAGAACGGCTATGG + Intronic
1145973009 17:28967992-28968014 AGGCAGGGTGGGGAGGCAGACGG - Intronic
1146173745 17:30651686-30651708 AGGCAGGCTGAGCAGGGAGCAGG - Intergenic
1146347201 17:32067707-32067729 AGGCAGGCTGAGCAGGGAGCAGG - Intergenic
1146815375 17:35937957-35937979 AAGCTGAGTGAGAAGGGAGATGG + Intronic
1147268758 17:39251713-39251735 AGGGAGGGTGGGAAGGAAGAAGG + Intergenic
1147384453 17:40073067-40073089 AGCCAGGGTGGGAAGAGAGAGGG - Intronic
1147949129 17:44097236-44097258 AGGCAGGGTGGGGTGGGAGAAGG + Intronic
1148439316 17:47703406-47703428 AGGGAGGGTGAGAAGCGTGAAGG - Intronic
1148676556 17:49448885-49448907 AGGCTGGGAGAGAAGGGAGAAGG + Intronic
1148768512 17:50053477-50053499 AGCCAGGGTAAGAAGGGCAGGGG - Intergenic
1149535845 17:57432677-57432699 GGTCAGTGTGAGGAGGGCGAAGG - Intronic
1149810304 17:59662938-59662960 AGGGAGGGTGAGAACAGCCAAGG + Intronic
1150269029 17:63850488-63850510 AGGCAGGGAGGGAAGGGAGAGGG + Intergenic
1150633850 17:66898921-66898943 AGGAAGGGTGGGAGGAGCGATGG - Intergenic
1151191208 17:72399467-72399489 TGGAGGGGTGAGAAGGGCAAGGG - Intergenic
1151500340 17:74484199-74484221 GGGCAGGCTGAGAAGGACGTGGG - Exonic
1151811152 17:76442836-76442858 AGGCAGGGAGACCAGGGAGAAGG + Intronic
1152898495 17:82926922-82926944 AGTCAGGGTGGGAAGTGGGAGGG + Intronic
1153911362 18:9708647-9708669 AGGCGGGGTGCGGAGAGCGAGGG - Intronic
1154172904 18:12063717-12063739 AGGCAGGGAAAGAAGGGAGATGG - Intergenic
1155208387 18:23580273-23580295 AGGCAGGAGGACAAGGGGGATGG - Intronic
1155352141 18:24917406-24917428 AGGCAGGGAGGGAAAGGGGAGGG + Intergenic
1155402681 18:25456488-25456510 AGGCACGGTGGGAGGGGCGCTGG + Intergenic
1155622102 18:27790935-27790957 AGGCAGGGGAGGAAGGGAGAGGG + Intergenic
1156475434 18:37402886-37402908 AGGCTGGGGGAGAAGGGCCCAGG - Intronic
1156475508 18:37403138-37403160 AGGCAGAGAGAGAAGGAAGAGGG + Intronic
1157190928 18:45581028-45581050 AGGCAGGGAGACCAGGGCCATGG + Intronic
1157334671 18:46729200-46729222 AGGCAGGATGAGAAGGTGTAGGG - Intronic
1157563463 18:48664264-48664286 CGGCAGGGTGAGGAAGGTGAGGG + Intronic
1157580938 18:48773788-48773810 AGGCAGGTTGGTATGGGCGAAGG - Intronic
1157583596 18:48787376-48787398 AGGAAGGGAGAGAAGGAGGAAGG + Intronic
1157589264 18:48826491-48826513 AGGCAGGGTGAGGAGGCGGTGGG - Intronic
1158517996 18:58146709-58146731 AGGCAGGGTGAGGATGTGGAAGG + Intronic
1158982656 18:62779366-62779388 AGGCAGGGTGACAAGTACCATGG - Intronic
1160559804 18:79749245-79749267 AAGCAGGGAGAGGAGGGGGAGGG - Intronic
1160840453 19:1144393-1144415 AGGCAGGGTGGGCAGGGAGCCGG + Intronic
1161241236 19:3225013-3225035 AGGGAGGGGGAGAGGGGGGAGGG - Intronic
1161267390 19:3370605-3370627 AGAGAGGGAGAGAAGGGAGACGG - Intronic
1161998862 19:7730867-7730889 CCGCAGGGTGAGAGGGGCGAGGG + Intronic
1162007308 19:7788766-7788788 CCGCGGGGTGAGAGGGGCGAGGG - Intergenic
1162988672 19:14288354-14288376 AGGCAGGCTGAGCAGGGAGCAGG + Intergenic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163732286 19:18956012-18956034 AGGGAGGTTGAGAAGGTGGATGG + Intergenic
1163827810 19:19533431-19533453 AGGAAGGAGGAGAAAGGCGAGGG - Intronic
1164654554 19:29910746-29910768 AGGGAGGGTGGGAAGGACGGAGG - Intergenic
1164937027 19:32223039-32223061 AGGGAGGGTGGGAAGGAAGAAGG + Intergenic
1165021235 19:32926005-32926027 AGGCAGGGAAAGAAGGAAGAGGG - Intronic
1165034461 19:33022769-33022791 AGGAAGGCTGGGCAGGGCGAGGG + Intronic
1165140817 19:33698927-33698949 ATGCAGGGTGGGGAGGGCTATGG + Intronic
1165142859 19:33712852-33712874 AGGCAGAGTGAGAGGGCAGAGGG - Intronic
1165686424 19:37824992-37825014 AGGCAGGGTGGGTAAGGCCAAGG - Intergenic
1165751732 19:38264486-38264508 AGGCAGGGCGAGCTGGGCGCAGG - Exonic
1165843558 19:38803801-38803823 AGGAAGGGTGAGAGGGGCTGAGG + Intronic
1166301992 19:41916117-41916139 TGGCAGGGAGAGAAGGGAGGAGG - Intronic
1167056312 19:47113155-47113177 AGGAAGGGTGAGATGGGAGGGGG + Intronic
1167128451 19:47568216-47568238 ATGCAGGGAGAGAAGGGAGAAGG - Intergenic
1167602862 19:50464781-50464803 AGGCTGAGTGAGAAGGGCTTAGG + Intronic
1168346387 19:55652107-55652129 AGGCAGGGAGACGAGGGTGATGG + Intronic
1168379502 19:55908015-55908037 AGGCAGGGTGAGGAGGCAGACGG - Intronic
1168519909 19:57041628-57041650 GGACAGGGTGAGGAGGGGGAAGG - Intergenic
1202697523 1_KI270712v1_random:135820-135842 GGGGAGGGTGGGAAGGGGGAAGG - Intergenic
925752424 2:7101021-7101043 AGGAAGAGGGAGAAGGGAGAAGG - Intergenic
926139943 2:10362531-10362553 AGGAAAGGTGAGCTGGGCGATGG + Intronic
926634999 2:15169408-15169430 AGACAGGGAGAGAAGTGGGATGG - Intronic
926846746 2:17149391-17149413 AGGCAGTGTGGCAAGGGCAAAGG + Intergenic
927667892 2:25044805-25044827 AGGCAGGGTGAGGAGGGGGAGGG - Intronic
928322842 2:30296715-30296737 AGGCAGGGTGGGATGGGGAAGGG + Intronic
928373792 2:30759214-30759236 AGGGAGGGAGAGAAGAGGGAAGG - Intronic
928602411 2:32916154-32916176 AGGCAGGGAGGTAAGGGGGAGGG - Intergenic
929171114 2:38934434-38934456 AGGGAGGGATAGAAGGGGGAGGG - Intronic
929171136 2:38934499-38934521 AGGGAGGGAGAGAAGGGGGAGGG - Intronic
929171144 2:38934518-38934540 AGGGAGGGAGAGAAGGGGGAGGG - Intronic
929171152 2:38934537-38934559 AGGAAGGGAGAAAAGGGGGAGGG - Intronic
929171198 2:38934665-38934687 AGGGAGGGAGAGAGGGGGGAGGG - Intronic
929922783 2:46184510-46184532 AGTCAAGGTGAGAAGGAAGAAGG - Intronic
931221863 2:60295644-60295666 GGGCAGGGAGAGGAGGGAGAGGG - Intergenic
931925540 2:67068052-67068074 AGGAAAGGAGAGAAGGGAGAGGG - Intergenic
933227303 2:79765862-79765884 AGGCAATGGGAGAAGGGCAAAGG - Intronic
933967156 2:87439620-87439642 AGGCAGGGTGAAGAGGTCGAAGG - Intergenic
934553744 2:95276900-95276922 AGGCAGGATGGGAATGGGGAGGG + Intronic
935404490 2:102694607-102694629 TGGCAGGGTGAGAGGGAGGAGGG + Intronic
935405107 2:102700433-102700455 AGGGAGGGTGAGAAGGAGGTTGG + Intronic
935899971 2:107781235-107781257 ATGCAGGGAGAGAAGGGGGGAGG + Intergenic
936246209 2:110829668-110829690 AGGCAGGGGAAGAAGGAGGAAGG + Intronic
936326640 2:111510875-111510897 AGGCAGGGTGAAGAGGTGGAAGG + Intergenic
936851796 2:116908255-116908277 AGGAAGGGTGAGAAAGGGGCGGG - Intergenic
937075792 2:119105492-119105514 AGGCAGGGAGAGAACTGGGAAGG - Intergenic
937311340 2:120905218-120905240 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
937479208 2:122241576-122241598 AGGAAGGGTGAGAAGAAGGAAGG + Intergenic
938721570 2:134071711-134071733 AGGAAGGGTGAGAAATGGGAAGG - Intergenic
939472387 2:142640138-142640160 AGGAAGGGAGAGAAGGAGGAAGG - Intergenic
939477107 2:142701893-142701915 AGGGAGGGGGAGAGGGGAGAGGG - Intergenic
940117197 2:150221982-150222004 AGGAAGGGGGAAAAAGGCGATGG + Intergenic
941216608 2:162717664-162717686 AGTCAGGGTAAGAAGAGCTATGG - Intronic
942429779 2:175898402-175898424 AGGCAAGGAGAGAAGGGCATGGG + Intergenic
942529149 2:176889632-176889654 ATGCAGGCTGAGAATGGCAATGG + Intergenic
942687193 2:178545751-178545773 AATCAGGGGGAGAAGGGAGAAGG - Intronic
942919342 2:181352342-181352364 AGGGAGGGTGAGAAGCGGGGAGG - Intergenic
944852319 2:203732609-203732631 TGGCATGGGGAGAAGGGCAAAGG + Intronic
945624690 2:212188258-212188280 AGGGAGGGAGAGAAGAGGGAGGG - Intronic
945624694 2:212188273-212188295 AGGGAGGGAGAGAAGAGGGAGGG - Intronic
945624698 2:212188288-212188310 AGGGAGGGAGAGAAGAGGGAGGG - Intronic
946181034 2:217949038-217949060 AGGCAGGGTGAGAGGAGGGAGGG - Intronic
946689137 2:222297836-222297858 AGGCTGGGTGTGAAGGGAGTGGG + Intronic
947006020 2:225512488-225512510 AGGCAGGGAGGGAAGGAGGAAGG - Intronic
947333509 2:229055355-229055377 AGGCAGGGTGAGAAAAACAAGGG + Intronic
947607857 2:231500901-231500923 AGCCTGGGTGACAAGAGCGAGGG - Intergenic
948079277 2:235192136-235192158 AGGGAGGCTGGGAAGGGCGGCGG - Intergenic
948091884 2:235302046-235302068 AGGAAGAGAGAGAAGGGGGAAGG - Intergenic
948519926 2:238529663-238529685 AGGCAGGGGAAGAAGGGGGGAGG + Intergenic
948588217 2:239034530-239034552 AGGCAGGGTGAGCAGTGTGTGGG - Intergenic
948755197 2:240155374-240155396 AGTCAGAGGGAGGAGGGCGATGG - Intergenic
949009799 2:241671973-241671995 GGGCAGGGTGAGGAGGGCAGGGG - Intronic
1169091709 20:2864912-2864934 AGCCTGGGTGAGGAGGGCGAGGG + Intronic
1169277824 20:4245433-4245455 AGGCAGGGAGAGAAAGAGGAAGG + Intronic
1169724543 20:8714693-8714715 AGGCCTGGTGAGAAGGGGCACGG + Intronic
1170438345 20:16352731-16352753 AGAGCGGGTGAGGAGGGCGAGGG + Intronic
1170696960 20:18667788-18667810 AGGCGTGGGGAGAAGGGAGAGGG - Intronic
1172010344 20:31842808-31842830 GGGCATGGTGAGGAGGGGGAAGG - Intergenic
1172271526 20:33658102-33658124 AGGCAGTGTGAGAAGGGCCGGGG - Intronic
1172554194 20:35826549-35826571 TGGCAGGGGGAGAAGGCAGAAGG + Intronic
1172594263 20:36139165-36139187 AGGCAGTGTGGGAAGGGAGACGG + Intronic
1172720783 20:36999437-36999459 AGGGAGGGAGAGGAGGGAGAGGG - Intronic
1173305210 20:41841274-41841296 AGGCAGGGAGGGAAGGACGGAGG - Intergenic
1174092957 20:48063888-48063910 AGGCAGGGAGAAAATGGGGAGGG + Intergenic
1174364515 20:50048452-50048474 AGGCAAGGTAAGGTGGGCGAGGG + Intergenic
1174519462 20:51118525-51118547 AGGCAGGAGGAGAAGAGCAAGGG - Intergenic
1175735246 20:61381541-61381563 AGGCATCCTGAGAAGGGAGAAGG - Intronic
1175742249 20:61427891-61427913 AGGCGGGGAGAGAAGGAGGAAGG + Intronic
1176887459 21:14273802-14273824 AGGCAAGGTGTGGAGGGAGACGG - Intergenic
1177948268 21:27500573-27500595 TGGCAGGGTGGGGAGGGGGAGGG + Intergenic
1178420282 21:32437746-32437768 ACGCAGGGTGTGTAGGGAGAGGG - Intronic
1178666031 21:34547317-34547339 AGGGAGGGGGAGAAAGGTGAGGG - Intronic
1179351958 21:40620410-40620432 AGGGAGGGAGAGAAGAGGGAGGG + Intronic
1180926729 22:19560164-19560186 TTGCAGGGTGGGAAGGGTGATGG + Intergenic
1181039177 22:20183898-20183920 GGCCAGGGTGGGAAGGGCCAGGG + Intergenic
1181527198 22:23496696-23496718 AGGCAGGGTGAGGAGGCCAGAGG + Intergenic
1181770270 22:25120140-25120162 AGGCAGTGGGAGATGGGGGAAGG - Intronic
1182547678 22:31085285-31085307 AGGCAGGGTGGGCGAGGCGAGGG + Intronic
1182967730 22:34537801-34537823 AGGAAGAGAGAGAAGGGTGAGGG + Intergenic
1183087509 22:35495507-35495529 AGGCAGGGAGAGAAGGGAGCAGG + Intergenic
1183102593 22:35593097-35593119 AGGGAGGGAGAGAAGGGTGGGGG + Intergenic
1183188968 22:36309253-36309275 AGGCAGGGGGCGAAGGGCAAAGG + Intronic
1183590175 22:38775450-38775472 AGTCAGTGTGAGAAGGTGGAGGG - Intronic
1183666129 22:39246881-39246903 AGACAGGGTGACAAGGGAGATGG + Intergenic
1183685803 22:39360800-39360822 AGCCAGGCAGAGAAGGGGGAAGG + Intronic
1183698787 22:39438138-39438160 AGGAAGGGAGGGAAGGGGGAAGG - Intergenic
1184103361 22:42353370-42353392 GGGAAGGGTGAGAAGAGGGATGG + Intergenic
1184262183 22:43324753-43324775 AGGCAGGTGGAGCAGGGAGATGG + Intronic
1184390631 22:44201263-44201285 AGGGAGGGTGAGTGGGGAGAGGG - Intronic
1184443617 22:44534366-44534388 AGGCAGGGTGAGGAGGCAGCTGG + Intergenic
1184481935 22:44752933-44752955 ACGCAGGCTGAGAGAGGCGAGGG - Intronic
1184642388 22:45879472-45879494 AAGCAGGGAGGGAAGGGGGAGGG - Intergenic
1185031179 22:48443771-48443793 AGGCAGGGTGAAGAGAGCCAGGG - Intergenic
1203294700 22_KI270736v1_random:30729-30751 AGGCAGGATTAGAAAGACGAGGG - Intergenic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950426438 3:12927121-12927143 AGGGAGGGAGAGAAGGGTGTGGG - Intronic
950696532 3:14705000-14705022 AGCCAGGGAGAGAAGGATGAAGG - Intronic
951444354 3:22761029-22761051 AGGCAGGGTGACAGGGATGAAGG - Intergenic
951760975 3:26147178-26147200 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
951959481 3:28300717-28300739 AGGCAGGGAGAGAGGGAGGAAGG - Intronic
953231595 3:41070114-41070136 AGGCAGGGGGTGAATGGCGGTGG + Intergenic
953260195 3:41330847-41330869 AAGCAGGGTGAGGAGGTCAAAGG + Intronic
953548838 3:43884849-43884871 AGGCAGCGGGAGGAGGGAGATGG + Intergenic
953852086 3:46472070-46472092 GGGAAGGGTGAGAAGGGAGGAGG - Intronic
954111047 3:48433312-48433334 TGGCTGGGTCAGAAGGGCAAAGG + Intronic
954117967 3:48477777-48477799 AGGCAGGGTGTGGAGGGAGTGGG - Intronic
954137969 3:48590894-48590916 ACGCAGAGTGAGAAGGGCCATGG + Intronic
954456776 3:50603908-50603930 AGGAGGGGTGGGAAGGGCAAAGG - Intergenic
954962110 3:54575804-54575826 AGGCAGGGAGAGAAGGAGGAAGG + Intronic
955198923 3:56831931-56831953 AGGAAGAGTCAGAAGGGCAAAGG + Intronic
955561489 3:60195875-60195897 AGGGAGGGTGGGAGGGGCGTGGG + Intronic
955688373 3:61566476-61566498 AGGCAGGGAGACAAGGGAGTAGG - Intronic
955793855 3:62614857-62614879 AGAGAGGCTGAGAAGGGTGAGGG - Intronic
956744698 3:72302061-72302083 AGGCAGCGTGTGATGGGCCACGG - Intergenic
957607135 3:82415647-82415669 AGGCTGGGTGGGAAGTGGGAAGG + Intergenic
959456110 3:106563714-106563736 AGGGAGGGAGGGAAGGGGGAAGG + Intergenic
960992026 3:123318130-123318152 GGGCAGGGTGAGAGGGGCCAAGG + Intronic
961649367 3:128409844-128409866 AGGTAGGGTGAGGAGGCCGTGGG - Intergenic
961941009 3:130637047-130637069 GGGGAGGGAGAGAAGGGGGAGGG - Intronic
962869244 3:139473789-139473811 CGGCAGGTTGAGAAGGACAAGGG + Intronic
963127185 3:141827148-141827170 AGGCAGGGTGGGAAGAGAGCTGG + Intergenic
963742977 3:149097961-149097983 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
963952155 3:151214586-151214608 AGGGAGGGGGAGAGGGGAGAAGG - Intronic
964545635 3:157830438-157830460 AAGCAGGGGGAGAAGGCCGGGGG - Intergenic
966155991 3:176917087-176917109 AGGCAGGGTGAGAAAGTCCGTGG - Intergenic
966861403 3:184232858-184232880 AGGCAGGGGGAGAGGGGCAGAGG + Intronic
966869690 3:184282179-184282201 AGGTAGGGAGAGAAGGGGTAAGG + Intronic
968140810 3:196254877-196254899 AGGGAGAGTGTGAAGGGCAATGG - Intronic
968266960 3:197369878-197369900 AAGCGGGGAGAGAAGGGGGAGGG - Intergenic
968702683 4:2064342-2064364 AGGCAGGTGGGGAAGGGCGAGGG - Exonic
969184171 4:5463205-5463227 ACTCAGGGTGAGACTGGCGAAGG + Intronic
969459525 4:7321682-7321704 GGGCTGGGTGAGGAGGGTGATGG + Intronic
969489318 4:7490254-7490276 AGGCCGAGTCAGAAGGGAGATGG - Intronic
969507056 4:7594602-7594624 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
969575846 4:8035245-8035267 AGGGAGGGTGAGAAGAGCTCAGG - Intronic
970400482 4:15712666-15712688 AGTCAGGGTGAGAAGGACCTTGG + Intronic
971302974 4:25456956-25456978 AGGGAAGGTGAAAAGGGCCAAGG - Intergenic
971518103 4:27513775-27513797 AGACATGGAGAGAATGGCGATGG + Intergenic
971661675 4:29426052-29426074 AGGAAGGGCGAGAAGGGGGGGGG - Intergenic
971784443 4:31082777-31082799 AGGGAGGGTGGGAGGGGCTAAGG + Intronic
973019645 4:45186695-45186717 AGGAAGGGAGGGAAGGGGGAAGG - Intergenic
973681457 4:53324639-53324661 AGGCAGGGTAAGCAGGCTGAGGG + Intronic
973769719 4:54195369-54195391 AGGGAGGGGGAGAAGAGAGAAGG + Intronic
973858268 4:55035099-55035121 TGGAAGGGTGAGAAGGGAGTGGG - Intergenic
973865484 4:55108741-55108763 AGGAAGTGAGAGAAGGGAGAAGG - Intronic
974079064 4:57194458-57194480 AGGCAGGCAGAGAAGGGGGAAGG + Intergenic
974727624 4:65815990-65816012 AGGCAGGGTGTGATGAGGGAGGG - Intergenic
977093168 4:92704801-92704823 AGGCAGGGAGAAAAGAGGGAAGG - Intronic
978270153 4:106878961-106878983 AAGCAGGGTGAGAAGGGCTTTGG - Intergenic
979474146 4:121135063-121135085 AGGTGGGGAGAGAAGGTCGAGGG + Intronic
980113641 4:128658709-128658731 GGGAAGGGGGAGAAGGGAGAAGG + Intergenic
980344523 4:131596134-131596156 AGGGAGGGAGGGAAGGGCGGAGG - Intergenic
980508001 4:133747977-133747999 GGGCATGGGGAGAGGGGCGAGGG - Intergenic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
985053720 4:186017956-186017978 AGGCAGGGTGAGCAGGCTCAGGG + Intergenic
985446529 4:190023825-190023847 AGGGAGGGAGAGAAGGAGGAGGG - Intergenic
985451954 4:190067572-190067594 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985452941 4:190070863-190070885 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985453930 4:190074156-190074178 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985454918 4:190077449-190077471 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985455904 4:190080746-190080768 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985456889 4:190084040-190084062 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985457877 4:190087336-190087358 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985458865 4:190090633-190090655 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985463117 4:190173396-190173418 AGGAAGGGGGAGAGGGGGGAGGG - Intergenic
985523764 5:391523-391545 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523779 5:391572-391594 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523806 5:391670-391692 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523821 5:391719-391741 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523836 5:391768-391790 GGGCAGGGCGAGGAGGGCGCAGG + Intronic
985523885 5:391972-391994 ACGCAGGGCGAGGAGGGCGCAGG + Intronic
985523922 5:392127-392149 ACGCAGGGCGAGGAGGGCGCAGG + Intronic
986182550 5:5406905-5406927 AGGAAGGGTGAGAAGGTGGGAGG + Intergenic
986283976 5:6346510-6346532 AGGAAGGGTGAGAGGAGGGAAGG + Intergenic
986339130 5:6774599-6774621 AGGCAGGGAGAAGAGGGAGAAGG + Intergenic
986429809 5:7670241-7670263 AGGCAGAGTGAAAAGTGGGAGGG - Intronic
986879040 5:12147657-12147679 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986879048 5:12147681-12147703 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
987109088 5:14668003-14668025 AGACAGGCAGAGAAGGGCCATGG - Intronic
987194393 5:15510999-15511021 GGGCAGGGTGAGGAGGGGCATGG - Intronic
989069627 5:37497178-37497200 AGGCAGGGAGTGAGGGGGGAAGG - Intronic
989279232 5:39622076-39622098 AAGCATGGGGAGAAGGCCGAGGG - Intergenic
989387793 5:40870416-40870438 AGCCAGGCTGAGAAGGGCTGAGG - Intergenic
989554991 5:42783731-42783753 AGGGAGGGTGGGAGGGGTGAGGG - Intronic
990466871 5:56078956-56078978 GGGCAGGGAGAGAATGGAGAAGG + Intergenic
990989776 5:61673630-61673652 AAGCAGGGTGGCAAGGGCAAAGG - Intronic
992058846 5:73021341-73021363 AGGGAGGGTGAGAAAGGATAGGG + Intronic
992640435 5:78764230-78764252 AGGCAGGGTAAGAAGAGAGAGGG - Intronic
993013314 5:82508537-82508559 CAGCAGGGTGAGAAGGGTGATGG - Intergenic
993696797 5:91071132-91071154 AGAAAGGGAGAGAAGGGAGAGGG + Intronic
994367696 5:98934109-98934131 AGGCAGGGTTAGGAGGAGGAGGG + Intergenic
995225773 5:109699216-109699238 AGGGAGGGTGAGAAATGAGAAGG - Intronic
995466665 5:112456814-112456836 AGGAAGGGTGAGAGGGAGGAAGG + Intergenic
995994173 5:118279703-118279725 AGGCAGGATGAAAAAGGAGAGGG - Intergenic
996237404 5:121148727-121148749 TGGGAGGGTGAGATGGGGGAGGG - Intergenic
997152799 5:131517118-131517140 GGGCAGGGAGAGAGGGGCAAGGG + Intronic
997269649 5:132526075-132526097 GGGCAGGGTGAGAAGGCAGGTGG + Intergenic
998104103 5:139457386-139457408 ATGCAGGGTGAGAAGGGCTGCGG - Intronic
998849762 5:146341538-146341560 GGGCAGGGTGAGAAGGGTTCAGG - Intergenic
999230077 5:150056572-150056594 ACAAAGGGTGAGAAGGGCCATGG - Intronic
999327071 5:150650121-150650143 AGGCCCGGTGAGGAGCGCGAGGG - Exonic
999551018 5:152687249-152687271 AGTCAGGTTGAGAAAGGGGATGG + Intergenic
1000132130 5:158310081-158310103 AGGGAGGGAGGGAAGGGGGAGGG - Intergenic
1000361762 5:160454153-160454175 AGGCAGGGGGAGCAGGGGGGCGG - Intergenic
1000947442 5:167438819-167438841 AGTCTGGGTGACAAGAGCGAAGG - Intronic
1001147803 5:169200115-169200137 AAGCAAGGTGAGCAGGGCGAAGG + Intronic
1001554768 5:172629430-172629452 GGGCAGGGGAAGAAGGGCCAGGG - Intergenic
1001631462 5:173178550-173178572 AGGCCGGGGGAGAAGGGAGTGGG + Intergenic
1001745581 5:174089954-174089976 AGGCAGGAAGAGAAAGGCAAAGG + Intronic
1001758413 5:174188101-174188123 GGGGAGGGGGAGAAGGGAGAGGG - Intronic
1001775217 5:174323858-174323880 AGGAAGGGTGTGAAGGAGGAAGG - Intergenic
1001941305 5:175741704-175741726 AGGCAAGGCGGGAAGGGTGATGG + Intergenic
1002082150 5:176743534-176743556 AGGGAGGCTGAGAAGCGCCAAGG - Intergenic
1002317956 5:178356578-178356600 AGGCAGGGTGCAAAGGGTTAAGG + Intronic
1002453240 5:179331415-179331437 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453249 5:179331435-179331457 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453258 5:179331455-179331477 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453267 5:179331475-179331497 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453276 5:179331495-179331517 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453285 5:179331515-179331537 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453294 5:179331535-179331557 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453303 5:179331555-179331577 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453312 5:179331575-179331597 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453321 5:179331595-179331617 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002523332 5:179803223-179803245 AGGCAGGGTGTGGAGGGTGGGGG - Intronic
1002698895 5:181108890-181108912 AGGCAGGGTAGGAAGTGGGAGGG + Intergenic
1003131914 6:3402088-3402110 AGGAATGGGGAGAAGGGTGAAGG - Intronic
1003512614 6:6793940-6793962 GGGCAGGGTCAGAAGGGCCAAGG - Intergenic
1005967822 6:30740343-30740365 GGGCAGGGGGAGAAAGGCCACGG + Intronic
1006276673 6:33009709-33009731 AGCCGGGGTGAGAAGGTGGAAGG + Intergenic
1006451475 6:34108078-34108100 AGGCTGGGTGAGGAGGGGCAGGG + Intronic
1006601701 6:35230870-35230892 AGGCAAACTGAGAAGGGCCATGG + Intronic
1006618632 6:35346783-35346805 AGGCAAGGTAAGAAGGGAGCTGG - Intronic
1007596598 6:43054574-43054596 ACTCAAGGAGAGAAGGGCGAGGG + Intronic
1007626830 6:43251516-43251538 AGGCATGGGGAGCAGGGAGACGG - Intronic
1007749757 6:44064661-44064683 AGGCAGGGGAAGAAAGGCCATGG + Intergenic
1007957218 6:45929118-45929140 AGGCATGGGGAGAAGGGGGTGGG - Intronic
1008585783 6:52947675-52947697 AGGGAGGGAGAGAGGGACGAAGG + Intergenic
1008666284 6:53720233-53720255 TGGAAGGGTGAGAAGGGAGTAGG - Intergenic
1010134954 6:72540869-72540891 AGGCAGGGTGAAAGGGGGCAAGG - Intergenic
1010951992 6:82048246-82048268 AGTGAGGGTTAGAAGGGGGAAGG - Intergenic
1011410219 6:87059718-87059740 AGGCAGGGTGAGAGGGAGGTGGG + Intergenic
1011480553 6:87789426-87789448 AGGCAGGAGGAGAAGGGTTATGG + Intergenic
1011497981 6:87955175-87955197 AGGCATGGTGAGAGGGAGGAAGG - Intergenic
1012260646 6:97083503-97083525 AGGCAGGCAGAGAAGAGCAAGGG - Intronic
1014804856 6:125818055-125818077 AGGAAGGGGGAGAAGCGGGAAGG - Intronic
1015026632 6:128541305-128541327 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
1017669580 6:156756972-156756994 AGGGAGGGAGAGAAGAGAGAGGG + Intergenic
1017846352 6:158261875-158261897 AGAGAGGGTGGGAAGGGCAAAGG + Intronic
1017992877 6:159505880-159505902 AGGCAGGGAAAGAAAGGAGAAGG + Intergenic
1018058329 6:160071046-160071068 AGGCTGGGAGGGAAGGGTGAAGG + Intronic
1018320222 6:162600752-162600774 AGGAAGAGTGAGAAGGGGGAGGG - Intronic
1018665480 6:166132793-166132815 AGGGAGGGAGAGAAGGGGGGAGG + Intergenic
1019334920 7:478533-478555 AGGGAGGGAGAGAAGGAAGAAGG + Intergenic
1019563977 7:1670682-1670704 GGGCAGGGTGCGGACGGCGAAGG - Intergenic
1019608455 7:1922626-1922648 CAGCAGGGTGAGGAGGTCGAAGG - Intronic
1019941858 7:4298210-4298232 AGGAAGGGAGAAAAGGGAGAAGG - Intergenic
1019975050 7:4574455-4574477 AGGAAGAGAGAGAAGGGGGAGGG - Intergenic
1020033186 7:4947365-4947387 AGGAAGGGAGAGAAGGAAGAGGG + Intronic
1020360907 7:7325619-7325641 AGGCAGTGTGGAAAGGGCGCTGG + Intergenic
1020446544 7:8274898-8274920 AAGCAGGGTTAGAAAGGCAATGG - Intergenic
1020877245 7:13713472-13713494 AGGGAGGGAGGGAAGGGGGAAGG + Intergenic
1021719497 7:23491761-23491783 AGGCAGGGAGAGAAGGAGGGAGG - Intergenic
1022551903 7:31248736-31248758 AAGCAGGGAGAGAAGGGCCCAGG - Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022649720 7:32263314-32263336 ATGCAGGGGGAGGAGGGAGAAGG - Intronic
1023156425 7:37256662-37256684 AGGGAGGGAGAGAAGGGAGAAGG + Intronic
1023277306 7:38533786-38533808 AGGCAGGCTGAGAAGGGCTTGGG - Intronic
1023352589 7:39335157-39335179 AGGGAGGTGGAGAAGGGCCATGG - Intronic
1023565705 7:41522006-41522028 AGGGAGGGAGAGAAGGAGGAAGG + Intergenic
1023794525 7:43780739-43780761 TGGCAGGGTGAGAATGGGGATGG - Intronic
1023958767 7:44909537-44909559 AGGCTGGGTGAGATGTGAGATGG + Intergenic
1024308758 7:47949944-47949966 AGGCAGTGTGAGAAGAGCAGAGG - Intronic
1024577842 7:50779493-50779515 AGGGAGGGTGAGTAGAGGGATGG - Intronic
1024722241 7:52150101-52150123 GGGAAGGGAGAGAAGGGTGAGGG - Intergenic
1026125675 7:67577437-67577459 AGGAAGGGTGTGGAGGGCGGTGG + Intergenic
1026308776 7:69166160-69166182 GGGAAGGGGGAGAAGGGGGAGGG + Intergenic
1026677162 7:72437725-72437747 AGGAAGGGTGGGAGGGGGGAAGG - Intronic
1027538129 7:79432764-79432786 AGGCAGAGTGAGGTGTGCGATGG + Intronic
1027851061 7:83452506-83452528 AGGCAAGGTGAGCAGAGTGAAGG + Intronic
1029279902 7:99428882-99428904 AAGCAGGGTGGGAGGGGCGGGGG + Intronic
1030469617 7:109947358-109947380 AGGCATCCTGAGAAGGGCAATGG - Intergenic
1032436135 7:131901690-131901712 AATCAGCGTGAGAAGGGAGAGGG + Intergenic
1032539674 7:132692801-132692823 AGGGAGGATGGGGAGGGCGAGGG - Intronic
1032996115 7:137448556-137448578 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
1033150870 7:138913981-138914003 AGGGAGGGAGAGGAGGGAGAAGG + Intronic
1033254043 7:139784148-139784170 AGGGAGGGAGGGAAGGGGGAAGG - Intronic
1034072281 7:148198098-148198120 AGGCAGGCTGAGAAGCCTGAGGG + Intronic
1034466108 7:151230157-151230179 GGGCAGGGTGGGCAGGGGGAGGG - Intergenic
1034704260 7:153126751-153126773 AGGACGAGTGAGAAGGGAGATGG + Intergenic
1035343214 7:158178339-158178361 CGGGAGGGTGAGAGGGGAGAGGG - Intronic
1036442971 8:8797577-8797599 GGGCAGGGGGAGAAGGGCAGAGG + Intronic
1036785139 8:11680790-11680812 CGTCGGGGTGAGCAGGGCGAGGG - Intronic
1036788266 8:11702071-11702093 AGGGAGGATGGGGAGGGCGAGGG + Intronic
1037169401 8:15873875-15873897 AGGAAGGGTAGGAAGGGGGAAGG - Intergenic
1037169425 8:15873937-15873959 AGGCAGGGAGGGAGGGGGGAAGG - Intergenic
1037703509 8:21296046-21296068 AGGCTGGGTGAGATGAGGGAGGG - Intergenic
1037809263 8:22076939-22076961 AGACTTGGTGAGAATGGCGAGGG + Intronic
1038029313 8:23623155-23623177 TGGGAGGGTGAGGAGAGCGATGG + Intergenic
1038322124 8:26536882-26536904 AGGCAGTGAGAGAATGGTGAGGG + Intronic
1038450011 8:27633871-27633893 AGGAAGGGTGCGCGGGGCGAGGG + Intronic
1039365931 8:36927949-36927971 AGGGAGGGAGGGAAGGACGAAGG + Intronic
1040491319 8:47924969-47924991 AGGCAGGGTGAGAAGGGCGATGG - Intronic
1041042189 8:53858657-53858679 GGGAAGAGTGAAAAGGGCGATGG + Intronic
1041098120 8:54369833-54369855 AGGGAGGGAGAGAGGGGGGAGGG - Intergenic
1041107823 8:54459023-54459045 AGGAAGGGGGAGAGGGGCGCAGG - Intronic
1041367027 8:57117296-57117318 AGGTAGGGTGAGAAGTGGTAGGG + Intergenic
1041377504 8:57218351-57218373 AGGCAGCGTGTGAAGGGTGGAGG + Intergenic
1041686155 8:60646578-60646600 GGGCAGTGGGAGAAGGGGGAGGG - Intergenic
1043037743 8:75218973-75218995 AGGGAAGGAGAGAAGGGGGAAGG + Intergenic
1043128250 8:76427770-76427792 AAGCAGGGTGTGGAGGGAGAAGG - Intergenic
1044068111 8:87723167-87723189 AGGCAGGGCAGGAAGGGTGAGGG - Intergenic
1044590212 8:93907078-93907100 AGAAAGGGTGAAAAGGGGGAAGG - Intronic
1044983244 8:97736375-97736397 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1045378526 8:101600076-101600098 AGGCTGGGTGAGAAAGGAAACGG + Intronic
1045525279 8:102936124-102936146 AAACAGGGTGAGAAGTGGGAGGG + Intronic
1046922576 8:119748145-119748167 AGGGAGGGAGGGAAGGGGGAGGG + Intronic
1047736742 8:127772259-127772281 AGGGAGGGAGGGAGGGGCGAAGG + Intergenic
1048499261 8:134960866-134960888 AGGGAGGGTGAGATGGTGGATGG + Intergenic
1049344759 8:142132901-142132923 AGGCAGGTTGAGTAGGGGGCAGG + Intergenic
1049709021 8:144055423-144055445 AGGCAGGGTGGGAGGGTCGAGGG - Intronic
1050472680 9:6008381-6008403 GGGCAGGGAGAGAAGGGGGAGGG + Intergenic
1051053578 9:12957686-12957708 AGGAAAAGTGAGAAGGGTGAAGG - Intergenic
1051376802 9:16410262-16410284 AGGCAAGGTGTGAGGGGAGAGGG + Exonic
1053010587 9:34630667-34630689 AGGCAGGGAGAGCAGGGAGGAGG - Intergenic
1053221262 9:36315285-36315307 AAGCAGGGTGACAAGGGTGTGGG + Intergenic
1053337239 9:37286844-37286866 AGGGAGGGAGGGAAGGGGGAGGG - Intronic
1053337255 9:37286871-37286893 AGGGAGGGAGGGAAGGGGGAGGG - Intronic
1053337269 9:37286896-37286918 AGGGAGGGAGGGAAGGGGGAGGG - Intronic
1054355009 9:64051928-64051950 AGGCAAGGTGAGGGGGGCCAGGG - Intergenic
1054935828 9:70686742-70686764 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
1055030357 9:71767810-71767832 AGGCAGGGGGCGGAGGGCGGAGG + Intronic
1055417924 9:76104290-76104312 AAGCAGGATGAGAAGGGAGTGGG + Intronic
1056523173 9:87418826-87418848 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1057045770 9:91885323-91885345 GGGCAGGGTGTGGAGGGAGATGG + Intronic
1058481118 9:105396341-105396363 AGGCAGGGAGAAAAGTGTGAAGG + Exonic
1059111132 9:111559366-111559388 AAGTAGGGTGAGAAGGGCATTGG - Intronic
1059404799 9:114093035-114093057 GGGCAGGGTGAGGAGGGGGGAGG + Intronic
1060799201 9:126532977-126532999 AGCTAGGGAGAGAAGGGAGAGGG - Intergenic
1061128272 9:128689929-128689951 AGGGAGGGGGAGGAGAGCGAGGG - Intronic
1061165439 9:128919643-128919665 TGGCAGGGGGAGAAGAGGGAGGG - Intergenic
1061287207 9:129630900-129630922 AGGCAGAGTGAGAATGGCAGTGG - Intronic
1061662842 9:132141723-132141745 AGGCAGAGTGAGAAGCCCGCAGG + Intergenic
1061704310 9:132441025-132441047 AGGCAAGGAGAGAAGGGTGATGG - Intronic
1061725744 9:132580990-132581012 TGACGGGGTGGGAAGGGCGAGGG + Intergenic
1062018403 9:134303979-134304001 ATTCAGGCTGAGAAGGGAGAAGG - Intergenic
1062469771 9:136697151-136697173 AGGAAGGAGGAGAAGGGAGAGGG - Intergenic
1185490939 X:516572-516594 AGGAGGGGGGAGAAGGGAGAGGG - Intergenic
1185595839 X:1306271-1306293 AGGGAGGGAGAAAAGGGAGAAGG + Intronic
1185708506 X:2282839-2282861 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1186005625 X:5067436-5067458 AGGCAGGGAGAGAATAGCTAGGG + Intergenic
1186246600 X:7622422-7622444 AGGCAGGGAGGGAAGGAGGAAGG - Intergenic
1186473114 X:9836520-9836542 AGGGAGAGAGAGAAGGGAGAAGG - Intronic
1187274104 X:17803667-17803689 AGGCAGGAGGAGAAGGGGGGAGG + Intronic
1187405706 X:19001707-19001729 AGGCAGGGTGGCAAGGGTGGTGG + Intronic
1187464356 X:19514806-19514828 GGGACGGGGGAGAAGGGCGAGGG + Intronic
1187561868 X:20411003-20411025 AGGCAGAGAGGGAAGGGAGAAGG - Intergenic
1189229796 X:39443354-39443376 AGGCAGGGGGACAATGGGGAGGG + Intergenic
1189564136 X:42222263-42222285 AGAAAGGGTGAGTAGGGGGAAGG - Intergenic
1189739705 X:44105336-44105358 AGGGAAGGGGAGAAGGGAGAGGG + Intergenic
1190123412 X:47682744-47682766 AGGAAGGAGGAGAAGGGAGAAGG - Intergenic
1190179232 X:48177517-48177539 GGGGAGGGGGAGAAGGGAGAGGG + Intergenic
1190878395 X:54475592-54475614 AGGCAGAGAGACAAGGGAGAGGG - Intronic
1191024727 X:55901290-55901312 AGGCAGTGGGAGAAGGGAGGAGG - Intergenic
1191104675 X:56765115-56765137 AGGCAGGGTCAGCTGGGCGCGGG + Intergenic
1192931552 X:75811715-75811737 AGGAAGAGTGGGAAGGGGGAGGG - Intergenic
1194739267 X:97552920-97552942 GGGCACAGTGAGAAGGGCCAAGG - Intronic
1195769883 X:108339358-108339380 AAGGAGGATGAAAAGGGCGAAGG - Intronic
1197230557 X:123999435-123999457 AGACAGGGAGAGAAGGGGGAGGG - Intronic
1197746932 X:129937870-129937892 GGGCACAGTGAGAAGGGCGCAGG - Intergenic
1198054974 X:132984934-132984956 AGGAAGGGTGAGCAAGGAGAGGG - Intergenic
1198323994 X:135548884-135548906 AGGCGGGGGGAGAAGGAGGAAGG + Intronic
1198934744 X:141894817-141894839 GGGCAGGGAGAGGTGGGCGAAGG + Intronic
1199474507 X:148230964-148230986 AGGAAGGGAGAGAGGGGAGAAGG - Intergenic
1199511899 X:148631684-148631706 AGGCAGGGGGAGGAGGGCATGGG + Intronic
1200710457 Y:6479885-6479907 AGGGAGGGAGAGAAGGAAGAAGG + Intergenic
1201023480 Y:9682109-9682131 AGGGAGGGAGAGAAGGAAGAAGG - Intergenic