ID: 1040491320

View in Genome Browser
Species Human (GRCh38)
Location 8:47924975-47924997
Sequence GGGTGCAGGCAGGGTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 628}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491320_1040491330 8 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491320_1040491335 26 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491335 8:47925024-47925046 CGTGGGTGCCTCATCTGGCTTGG No data
1040491320_1040491336 27 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491336 8:47925025-47925047 GTGGGTGCCTCATCTGGCTTGGG No data
1040491320_1040491334 21 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data
1040491320_1040491331 9 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491320 Original CRISPR GGGTGCAGGCAGGGTGAGAA GGG (reversed) Intronic
900157356 1:1208635-1208657 GGGGGCGGGGAGGGTGAGCATGG + Intergenic
900437745 1:2639610-2639632 GGGTGAAGACAGGGAGGGAAGGG + Intronic
900972621 1:5999954-5999976 GGGTGCAGGCAGGGTGCGGACGG - Intronic
900972643 1:6000059-6000081 GAGTGCAGGCAGGGTGTGGACGG - Intronic
901291150 1:8125573-8125595 AGGGCCAGGCAGGGTGAGGAGGG - Intergenic
901504140 1:9673855-9673877 GGGTGCACCCTGGGTGTGAAAGG - Intronic
901638691 1:10682283-10682305 GGGTGCCGGGACGGGGAGAAGGG + Intronic
901834123 1:11912608-11912630 GGGGGCAGGCAGGGTAAGGAAGG + Intergenic
901933005 1:12608925-12608947 GGGAGCAGGCTGGGTGACAAGGG - Intronic
902057587 1:13615134-13615156 GGGTGCACGCAGGGCAAGAGCGG - Intronic
902290178 1:15430230-15430252 GGGAGAAGGGAAGGTGAGAAGGG - Exonic
902793922 1:18787972-18787994 GGGAGGAGGGAGGGAGAGAAAGG + Intergenic
903713939 1:25348957-25348979 GGGCTCAGGCAGGGTGGGAAGGG + Intronic
903868731 1:26417042-26417064 GGGTGGGGGCAGGGTGGGACGGG + Intronic
904313058 1:29641814-29641836 AGGTGCAGGCAGAGTGGGAGGGG - Intergenic
904439618 1:30521866-30521888 GGGTGAAGCGAGGGTGGGAAGGG - Intergenic
905777993 1:40682564-40682586 GACTCCAGGCAGGGAGAGAATGG - Intergenic
905791544 1:40792207-40792229 GGGAGGGGGCAGGGAGAGAAAGG + Intronic
905907426 1:41628235-41628257 GGGGGCAGGTGGGGTGAGAAAGG + Intronic
906265695 1:44427448-44427470 CAGTGCAGGGAGGGTGAAAAGGG - Intronic
906609014 1:47189544-47189566 GGGTACAAGTAGGGTGAGAGTGG - Intronic
907052674 1:51340269-51340291 GGTGGCAGTCAGGGAGAGAAGGG + Intronic
907144945 1:52223271-52223293 GGGAACAGGGAGGGGGAGAAGGG - Intronic
907377045 1:54052839-54052861 GGGTGCAGGCAGGATTAGGGAGG + Intronic
907602059 1:55781854-55781876 AGGTGCAGGCTGGGAGAGAGAGG + Intergenic
907936874 1:59049327-59049349 GGGTGGAGGGAGGTTGTGAAGGG + Intergenic
907967623 1:59348331-59348353 GAGTGCAGGTGGGATGAGAAAGG - Intronic
910492371 1:87786677-87786699 GGCTGCAGCCAGGGTGGGAATGG + Intergenic
911121054 1:94296988-94297010 TAGTGCAGGGAGGATGAGAATGG + Intergenic
911125805 1:94339923-94339945 GGGTGAAGGGAGGGTGAGAAAGG - Intergenic
912703449 1:111895194-111895216 GGGAGGAGGCAGGGTGAGGACGG + Intronic
912710001 1:111943330-111943352 GGCTGCAGGCTGGGTGAGGCTGG - Intronic
913220101 1:116653102-116653124 GGATGCAGGCAGGATGATCATGG + Intronic
914505311 1:148283826-148283848 GGGTGGAGGTGGGGCGAGAATGG - Intergenic
914507251 1:148300321-148300343 GGGTGGAGGTGGGGCGAGAATGG + Intergenic
914689121 1:150010277-150010299 AGGAGCAGTCAGGGCGAGAAAGG + Intronic
914808711 1:151010457-151010479 GGATGAATGCAGGGAGAGAAAGG - Intronic
914865588 1:151425508-151425530 GGGTGGAGGCGAGGGGAGAATGG - Intronic
915758428 1:158286380-158286402 GGGTGGAGGTAGTGTAAGAAGGG - Intergenic
916430115 1:164719900-164719922 GTTTGCAGGCAGGGTGAAATGGG - Intronic
916490809 1:165300814-165300836 AGAAGCAGGCAGGGTGAGAAGGG - Intronic
916941621 1:169684018-169684040 GGGTGGAGACATGGAGAGAAGGG - Intronic
917694531 1:177508326-177508348 GGATACAAGCAGGGTGACAATGG - Intergenic
917723937 1:177812225-177812247 GGGTGGAGGGAGAGTAAGAATGG - Intergenic
919321268 1:196042560-196042582 GAGTGGTGTCAGGGTGAGAAAGG - Intergenic
919790899 1:201290379-201290401 GGGTGCATGCAGCATGAGCAGGG - Intronic
919843160 1:201623615-201623637 GGGAGCAGGCAGGGAGGGAAGGG + Intronic
919847621 1:201651425-201651447 AGGTGCAGGGAGGGCGAGAGAGG + Intronic
919882395 1:201909167-201909189 GAGGTCAGGCAGGGTGGGAATGG - Intronic
920165209 1:204031055-204031077 GGGTGCAGGCAAAGGGAAAAGGG - Intergenic
920188564 1:204177855-204177877 GGTTGCAGTCATGGTGGGAAAGG - Intergenic
920398277 1:205661822-205661844 GGGTGGAGTCAGGGTGGGAGGGG - Intronic
920652818 1:207851452-207851474 GGTGGCATGCAGAGTGAGAAGGG + Intergenic
920670869 1:208002905-208002927 GGGAGCAGGAAGGGAGAGACTGG - Intergenic
920696443 1:208184529-208184551 GGGTGTAGGCAGGGATGGAAGGG + Intronic
920830638 1:209462107-209462129 GAGTGGAGGCAGGGTGTGATAGG + Intergenic
922423662 1:225475347-225475369 GTGGGCAGGCTGGGTGAGATTGG + Intergenic
923552002 1:234971392-234971414 GGTTTCAGGCAGGCAGAGAAAGG + Intergenic
924319010 1:242828555-242828577 GGGTCCAGGCAGAATGAAAAGGG + Intergenic
924623836 1:245684610-245684632 GGGTCCAGGCTGGGTGACCAGGG - Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1063379594 10:5575971-5575993 GGGTGGGGGCCGGGTGAGAGGGG + Intergenic
1063650980 10:7936582-7936604 GGGAGCAGGCAGTGGGTGAATGG - Intronic
1063812720 10:9732117-9732139 GGGAGCAGGCAGCTGGAGAACGG + Intergenic
1064580376 10:16787389-16787411 GGGCCCAGGCAGAGTGAGGAGGG - Intronic
1065008703 10:21402700-21402722 GGATGCAGGCAGGGAGAGGTGGG - Intergenic
1065624709 10:27618727-27618749 GGTGGCAGGCAGGGAGAAAAGGG + Intergenic
1065968017 10:30784498-30784520 GGGGGCAGGCGGGGGGAGAGGGG - Intergenic
1067292112 10:44950940-44950962 GGGTGCAGGCACCTTGGGAAGGG - Intergenic
1067295499 10:44973197-44973219 GGGGGCAGGCAGGGTGAGACAGG - Intronic
1067522119 10:47015862-47015884 TGAAGCAGGCAGTGTGAGAAAGG + Intergenic
1067849852 10:49747484-49747506 TGGGGAAGGCAGGGAGAGAAGGG + Intronic
1068962222 10:62878039-62878061 GGGTGGGGGCAGGGTGAGGTGGG - Intronic
1069627612 10:69877993-69878015 GGGTGCAGGAAGGGAAAGGAGGG - Intronic
1069886660 10:71628005-71628027 TGGGGCAGGCAGGGGGAGTATGG - Intronic
1070065291 10:73027739-73027761 GGATGCAGGGAGGGAGGGAAGGG + Intronic
1071237059 10:83661469-83661491 TGGAGGAAGCAGGGTGAGAAAGG - Intergenic
1071432816 10:85619560-85619582 GGGTAGAGGCAGGGAGAAAACGG - Intronic
1071433548 10:85625642-85625664 GGGAGCAGGTAGACTGAGAAGGG - Intronic
1071794461 10:88990504-88990526 GGGAGAAGTCAGGGTGAGGAAGG - Intronic
1071799954 10:89048132-89048154 GGGTTCAAGTAGGGTGAGATTGG - Intergenic
1072011509 10:91306349-91306371 GGGTACAGACATGGAGAGAAGGG + Intergenic
1072059504 10:91796451-91796473 GGATGGAGGCAGGGTGGGGATGG - Intergenic
1072614074 10:97038018-97038040 GGAGGCTGGGAGGGTGAGAAGGG - Intronic
1073041773 10:100612738-100612760 GGGTGGAGGCCAGGTGGGAAGGG - Intergenic
1073249901 10:102114945-102114967 GGAGGGAGGCAGGGAGAGAAAGG - Intronic
1073267202 10:102234882-102234904 AGAGGGAGGCAGGGTGAGAAGGG + Intronic
1074285860 10:112097734-112097756 ATGTGCAGGCAGGTTGAGAATGG - Intergenic
1074921643 10:118020438-118020460 GGGTGCAGTGAGGGTCAGAGTGG - Intronic
1076048319 10:127312740-127312762 GGGTGGAGGCACAGGGAGAATGG - Intronic
1076547746 10:131257172-131257194 GGGTGCAGGCAGGGCGGGGATGG + Intronic
1076806000 10:132858966-132858988 GGGTGCAGCCGGGGTGAGCCAGG + Intronic
1076987506 11:249537-249559 GGGTGCAGGGAGGGGGAGAGCGG + Intronic
1076987516 11:249561-249583 GGGTGCGGGGAGGGGGAGAGCGG + Intronic
1076987526 11:249585-249607 GGGTGCGGGGAGGGGGAGAGCGG + Intronic
1077008121 11:368821-368843 TGGTGCAGACCAGGTGAGAAAGG + Intergenic
1077131294 11:974041-974063 GGGAGGAGCCAGGGTGAGGAGGG + Intronic
1077178387 11:1200883-1200905 GGCTGCAGGCGGGGTGGGTAAGG - Intronic
1077284132 11:1758395-1758417 AGGCCCAGGCAGGGTGACAAGGG + Intronic
1077306143 11:1869470-1869492 GGGTGGTGGCAGGATGGGAAGGG + Intronic
1077552655 11:3208026-3208048 AGGCCCAGGCAGGGTGAGACCGG - Intergenic
1077896830 11:6459159-6459181 TGGTGCAGGCAGAGGGGGAAGGG + Intronic
1078025771 11:7694201-7694223 GACTGCAGTCAGGGTGAGATTGG - Intronic
1078363850 11:10691076-10691098 GAGAGGAGGCAGGGTGAGAGAGG + Intronic
1079023496 11:16927081-16927103 GGGTGGGGGCAGGGAGGGAATGG + Intronic
1080241596 11:30133457-30133479 GGGTGAATGAAGGGTGAGATTGG + Intergenic
1083179711 11:60977327-60977349 TGGTCCAGGCAGGGAGAGGATGG - Intronic
1083332310 11:61904673-61904695 GGAGGCAGGCAGGGTGGTAAGGG + Intronic
1083619233 11:64040774-64040796 GGGTGCAGGCAGAGGGAGAAGGG + Intronic
1083671093 11:64300248-64300270 GGGTGCAGGGAGGGAGAGGCAGG + Intergenic
1083775572 11:64892991-64893013 GGATGCAGTCAGGGTGGGATGGG + Intergenic
1083802265 11:65053463-65053485 GGGTGCAGGCAGCAAGAGGAGGG + Intronic
1084079639 11:66812963-66812985 GGTTACAGGTAGGGTGAGAGTGG + Intronic
1084151055 11:67288254-67288276 GGGAGAAGGCAGGGTAAAAATGG + Intergenic
1084174233 11:67415452-67415474 CGGAGCAGGCAGGGAGAGACGGG - Intronic
1084376252 11:68779834-68779856 AGGTGCAGGCAGGGGGACAGGGG + Intronic
1084522913 11:69675367-69675389 CGGGGCAGGCCGGGTAAGAACGG + Intronic
1084607188 11:70179271-70179293 GGGTGCAGTTAGGGTGAGGCGGG + Intronic
1085251688 11:75148155-75148177 GGGTGTGGGCGGGGTGAAAAGGG - Intronic
1086670894 11:89546361-89546383 GGATATAGGCAGGGTAAGAATGG - Intergenic
1087006343 11:93475887-93475909 TGGTGAAGGCAGGCTGAAAATGG - Intergenic
1087902944 11:103663114-103663136 GGGTGCAGGGAGGGAGACAGTGG + Intergenic
1087945679 11:104157555-104157577 GGGTGCAGTGAGAGGGAGAAGGG - Intronic
1089176434 11:116552169-116552191 GGGTGCAGGTGGGATGGGAAGGG - Intergenic
1089309947 11:117551492-117551514 GGGTGCAGGCAGGGAGAGTCAGG - Intronic
1089396964 11:118142440-118142462 GGGTGCCAGCAGGGTGAATAGGG - Intronic
1089785338 11:120903447-120903469 GGGTGGAGGCAGGGTGGGGCGGG - Intronic
1089953030 11:122547521-122547543 GGGTAGAGGCAAGGAGAGAAGGG - Intergenic
1090217060 11:124977987-124978009 GGGTGAAAGGAGGGTGAGGATGG - Intronic
1090393352 11:126403687-126403709 GGGAGCAGGGAGGGTGAGAGAGG + Intronic
1090406631 11:126479689-126479711 GGGAGCAGGCAGCCTGTGAAGGG - Intronic
1090433312 11:126664775-126664797 GGCTGCAGCCAGGGTTAGAAAGG - Intronic
1090962884 11:131572858-131572880 GGGTGCAGGTGGAGTGAGAACGG + Intronic
1091027595 11:132155885-132155907 GGGTGCAGGTAGGGTGTGTAAGG + Intronic
1091121351 11:133060546-133060568 AGGTGCAGGCAGGGTGTGGAGGG + Intronic
1091220417 11:133927155-133927177 GGGTGCATGCAGGGTGCTCAGGG + Intronic
1091301508 11:134510792-134510814 GGGTGAAGGCTGGGTGAGCAGGG - Intergenic
1091807557 12:3366753-3366775 GGGTGCAGGCAGGGACAGCTGGG - Intergenic
1092126719 12:6079883-6079905 GGGAGCAGGGAGGGTGAGGCTGG - Intronic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092698580 12:11201751-11201773 GGGTGGAGGGAGGGAGAGAGGGG + Intergenic
1092912002 12:13153750-13153772 GGGTGAAGGAAGGGAGAGAAGGG - Intergenic
1092994227 12:13933254-13933276 GGGTGCTGGCAGGGAGACAATGG - Intronic
1093480711 12:19601452-19601474 GGGGGCAGGGAGGGATAGAATGG + Intronic
1094189303 12:27681013-27681035 GGGTGGGGGCAGGGTGCGGAGGG - Intronic
1094387098 12:29907049-29907071 GGGAGCAGGGAGGGAGAGCAAGG + Intergenic
1094492494 12:30969792-30969814 GGCACAAGGCAGGGTGAGAAGGG + Intronic
1094818132 12:34205890-34205912 GGGCGCAGGCAGGTGGAAAAGGG - Intergenic
1095220586 12:39608866-39608888 GGGTGAAGGATGGTTGAGAAAGG - Intronic
1095945896 12:47753302-47753324 GGGTGTAGGGAGACTGAGAATGG - Intronic
1097223244 12:57462361-57462383 GGGTGAGGGCGGGGTGAGATGGG - Intronic
1097542406 12:60956702-60956724 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
1097624139 12:61979529-61979551 GGGTATAGGAAGAGTGAGAAAGG + Intronic
1099010402 12:77284775-77284797 GGAGGCAGGCAGGGAGTGAAGGG + Intergenic
1099508823 12:83508954-83508976 GGGTAAAGGCAGGGTGTAAAAGG - Intergenic
1100540926 12:95556641-95556663 GGGAGAGGGAAGGGTGAGAAAGG + Intergenic
1100829399 12:98503954-98503976 GGGGGCAGGGCGGGTAAGAACGG + Intergenic
1100940073 12:99716089-99716111 GGGTAGAGACAGGGAGAGAAGGG - Intronic
1103202683 12:119101180-119101202 GTCTGAAGGCAGGGTGAGCAGGG + Intronic
1103724250 12:122989881-122989903 GGGGGCGGGCAGGGCGAGCAGGG + Exonic
1103956875 12:124582295-124582317 GGGCCCTGGCAGGGTGAGGAAGG - Intergenic
1104771370 12:131366735-131366757 AGGCGCAGGCAGGGTGAGCAAGG + Intergenic
1104920788 12:132289712-132289734 GGGTGGAGGGAGGATGGGAATGG - Intronic
1107508052 13:41055290-41055312 GGGTGCAGGTAGGATAGGAATGG - Intronic
1107749107 13:43545459-43545481 GGGTGGAGGCAGTGTTAGGATGG + Intronic
1107877428 13:44803090-44803112 AAGTGCAGACAGGGTGAGAAAGG - Intergenic
1110268693 13:73568794-73568816 GGCTGCAGGGAGGGTGAAAAAGG + Intergenic
1110308799 13:74022690-74022712 GGCTGCAGGTGGGGTGAGAGGGG - Intronic
1110654125 13:77976545-77976567 GAGTGGGGGCAGGGTAAGAAAGG - Intergenic
1110796941 13:79649942-79649964 GGAAGTAGGGAGGGTGAGAAGGG - Intergenic
1110802742 13:79718643-79718665 GGGTGGAAGGAGGGTGAGGATGG - Intergenic
1111046435 13:82819846-82819868 GGGTACAGGGAGGGGCAGAATGG + Intergenic
1111973784 13:94944787-94944809 GGGTACTGACAGGGTGAGGATGG - Intergenic
1112236609 13:97643208-97643230 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
1112795009 13:103047501-103047523 GGAGGAAGGCAGGGAGAGAAGGG - Intronic
1113676306 13:112209910-112209932 GGGTGCAGGCAGGGGCAGTTGGG + Intergenic
1113813999 13:113159227-113159249 CTGTGCAGGCAGAGTCAGAATGG - Exonic
1114454994 14:22848523-22848545 GGGTGGAGGCAGGAAGGGAAGGG - Intronic
1114522121 14:23346486-23346508 GGGAGGAGGCAGGGTGGGGACGG + Exonic
1114550065 14:23527579-23527601 GAGTACAGGCTGGGTGAGGACGG - Intronic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1114937345 14:27557251-27557273 GGGTGGAAGGAGGGTGAGGATGG + Intergenic
1115154535 14:30323038-30323060 GCAGGCAGGGAGGGTGAGAAGGG - Intergenic
1115904558 14:38191578-38191600 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
1119779762 14:77270242-77270264 GTGTGCAGGCCGGGTGGGAAGGG - Intronic
1120325139 14:83014349-83014371 GGGAGCAGGAAGGGAGAGAGAGG + Intergenic
1120788362 14:88557171-88557193 TCTAGCAGGCAGGGTGAGAAGGG - Intergenic
1120801275 14:88691296-88691318 GGGTGCAAACAGGGTAAGCAGGG + Intronic
1120905920 14:89621220-89621242 AGGTGCAGGAGGGCTGAGAAGGG - Intergenic
1121304592 14:92898149-92898171 GGGTGCAGGCAGGCTGTGGGTGG + Intergenic
1121389855 14:93564642-93564664 GGGTGCAGGCGGGCTGAGTCTGG + Intronic
1121830768 14:97050211-97050233 AGGTGTAGGCTGGGTGGGAAGGG - Intergenic
1122250922 14:100439124-100439146 GGGTGCAGGGAGGGTCAGAAAGG - Intronic
1122420705 14:101575159-101575181 GGGTGGGGGCAGAGAGAGAAGGG + Intergenic
1122810323 14:104284517-104284539 GGGTGCAGGCAGGAGGGGAGGGG + Intergenic
1122816232 14:104315529-104315551 GGGTGCAGTGAGGGCGAGATTGG - Intergenic
1122816583 14:104316974-104316996 GGGTGCAGGCAGATGGTGAATGG + Intergenic
1122835261 14:104427655-104427677 GGGTGCAGGGGGAGTGAGGAAGG - Intergenic
1123697843 15:22891885-22891907 AGGTGCAGGCAGCGTGTGAGCGG + Intronic
1124870617 15:33538399-33538421 GGGTGGAGGGAGGGAGGGAAAGG + Intronic
1126156362 15:45569121-45569143 GGGTACAGGCAGGCTCAGACAGG + Intergenic
1126208149 15:46069766-46069788 GGGTGCAGCAAAGGTGGGAAGGG + Intergenic
1126342113 15:47652455-47652477 GCGGGCAGGCGGGGTGAGGAGGG - Intronic
1127281523 15:57497358-57497380 GGGGGCAGGTAGGGGGAGCAGGG + Intronic
1128366644 15:67008289-67008311 AGCTGCAGGCAGGGGGAGGATGG - Intergenic
1129101159 15:73265328-73265350 AGCTGGAGGCAGGGTGGGAAGGG + Intronic
1129166327 15:73780282-73780304 GGGTGCAGTGGGGGTGAGGAGGG + Intergenic
1130096567 15:80860710-80860732 GGGTGCAGGCAAGGTGGGGGTGG - Intronic
1130355481 15:83126088-83126110 GGGTGCATGCAAGGTGGGTAGGG + Intronic
1130854866 15:87832100-87832122 GGGTAGAGGCAAGGAGAGAAGGG - Intergenic
1131174910 15:90203367-90203389 GGGAGAAGGCAGGGTGAGATGGG + Intronic
1131362249 15:91803519-91803541 CGGTGAAGGCAGTGTGACAATGG + Intergenic
1131565668 15:93483347-93483369 GGGTACAGGCAGGGTTGAAAGGG + Intergenic
1132207982 15:99999522-99999544 GGGTGGAGGCGGAGTGAGGAAGG + Intronic
1132693642 16:1192640-1192662 GGGTACAGGGAGGGTGTGAAAGG + Intronic
1133190393 16:4129567-4129589 TGATACAGGAAGGGTGAGAACGG + Intergenic
1133336597 16:5010684-5010706 GGGATCAGGGAGAGTGAGAAAGG - Intronic
1133406235 16:5526719-5526741 GGATGCAGGCTGGGGGAGAGGGG - Intergenic
1133937964 16:10284180-10284202 GGGTGGAGACATGGGGAGAAGGG - Intergenic
1134690807 16:16190091-16190113 GGGTGGGGGCAGGGTGAGGTAGG - Intronic
1135138853 16:19904793-19904815 GGGTGAAGGGAAGGTGAGAGTGG + Intergenic
1135860176 16:26049279-26049301 GGGTGAAGGCAAGGTGAGGGGGG + Intronic
1136174091 16:28505809-28505831 GGGAAGAGGCAGGGAGAGAAGGG - Intronic
1136608332 16:31351605-31351627 GACTGCAGGCAGGGAGAGGAAGG + Intergenic
1136996521 16:35194653-35194675 GATTGAAGGCAGGGTGAGACTGG + Intergenic
1137057076 16:35750996-35751018 GGGTGCAGGCAGGCTGGAAATGG - Intergenic
1137590421 16:49690022-49690044 GGGTGCAGGGAGGTGGAGTAGGG - Intronic
1137644668 16:50063596-50063618 GGGGACAGGCAGGGTGGAAATGG + Intergenic
1139088388 16:63616480-63616502 AGGTGCAGGCAGAGTGGCAAGGG + Intergenic
1139854166 16:69967630-69967652 GGGTGCAGGATGGGTGAGGGAGG - Intergenic
1139883147 16:70190544-70190566 GGGTGCAGGATGGGTGAGGGAGG - Intergenic
1140369361 16:74404976-74404998 GGGTGCAGGATGGGTGAGGGAGG + Intergenic
1141088072 16:81110791-81110813 GGATGGAGCCAGGGTGAGGATGG + Intergenic
1141185272 16:81782529-81782551 GGGTGCTGGCAGGATTTGAATGG + Intronic
1141265803 16:82495832-82495854 GGGTGGAGGAAGGGTAAGGAGGG + Intergenic
1141438144 16:84012648-84012670 GGGTGCAGGCTGGGTTAGAAAGG - Intronic
1141477516 16:84283754-84283776 GCATGCAGCCAGGCTGAGAAAGG + Intergenic
1141693165 16:85607698-85607720 GGGGGCAGGCAGGGAGAGGCGGG + Intergenic
1142359552 16:89619724-89619746 GGCTGCAGGGAGGGGGTGAAGGG - Intronic
1202997106 16_KI270728v1_random:124404-124426 GGGTGGAAGGAGGGGGAGAATGG + Intergenic
1203023793 16_KI270728v1_random:436746-436768 GGGTGGAAGGAGGGGGAGAATGG + Intergenic
1143178191 17:4968453-4968475 GGGTGCAGGCAGGAGGAGCTGGG + Exonic
1143812532 17:9483866-9483888 GGGCACAGGCAGGGTGGGAATGG + Intronic
1144331084 17:14224668-14224690 GAGTCCAAGCAGGGTGAAAAGGG - Intergenic
1144579597 17:16450871-16450893 GTGGGCAGGGAGGGTGAGGAGGG + Intronic
1145017610 17:19409417-19409439 GGATGCGGGGAGGGTGAGGAGGG - Intergenic
1145825543 17:27874657-27874679 GGGTGCTGGCAGGACGAGAGTGG + Intronic
1145885653 17:28380974-28380996 GGGAGGAGGGAGGGGGAGAACGG + Intronic
1145898080 17:28472270-28472292 GCGTGCAGTCAGGGTGAGGAGGG + Intronic
1145904479 17:28508674-28508696 GGGCGCTGGCAGGGACAGAAAGG + Intronic
1146494270 17:33307045-33307067 GGATGGGGCCAGGGTGAGAAGGG - Intronic
1146649630 17:34598611-34598633 GAGTGCAGGGAGGATGACAAAGG - Intronic
1146667447 17:34714648-34714670 GGGTGGGGGCAGGATGAAAAAGG - Intergenic
1147143099 17:38470014-38470036 GGGTGCAGGGAGGAGGAGGAAGG - Intronic
1147159741 17:38563031-38563053 GTGTGCAGGCAGCCTGAGATGGG - Intronic
1147421333 17:40323535-40323557 GGGTGCAGGCTGTGTGTGCAGGG - Intronic
1147427370 17:40352266-40352288 GGCTGGAGCCAGGCTGAGAAGGG + Intronic
1147685524 17:42284653-42284675 GGGTGTAGGCTGGGCGAGAATGG + Intergenic
1147743508 17:42681769-42681791 GGGGGCAGGGAGGGGGAGAAGGG - Intronic
1148864421 17:50621071-50621093 GGCTGCAGGCAGGCGGAGGAGGG + Intronic
1150461879 17:65360537-65360559 GTCAGCAGGCAGGGGGAGAAGGG + Intergenic
1150741214 17:67780313-67780335 GGGTGGAGGCAGGGCGAGGTGGG - Intergenic
1151174295 17:72274394-72274416 TGGTGGGGGCAGGGTGAGGAGGG + Intergenic
1151188094 17:72378709-72378731 GTGTGCAGGCAGGGGGAGGGCGG + Intergenic
1151310544 17:73290069-73290091 GGGTGCAGGCAGGTGGAAGATGG - Intronic
1151336605 17:73443685-73443707 GGATGCTGGCACAGTGAGAAAGG + Intronic
1151576203 17:74953696-74953718 GGGTGGAGGAAGGGCTAGAAGGG - Intronic
1151650227 17:75463325-75463347 GGGTGCAAGCAGGGCTAGAAAGG - Intronic
1151662665 17:75526762-75526784 GGGAGCGGGCAGGGAGGGAATGG + Intronic
1151832022 17:76558472-76558494 GGGTGCAGGCAGGGCCTGAGTGG + Intergenic
1152091446 17:78249832-78249854 AGGTGCAGGCAGAGTCAGAGGGG + Intergenic
1152424068 17:80209479-80209501 GGGTGGAGGCAGGGCAGGAACGG + Exonic
1152524569 17:80880121-80880143 GGGTGCAGGCAGGGGCTGCAGGG + Intronic
1152576609 17:81143943-81143965 AGGTGCACCCAGGGTGAGCACGG + Intronic
1153509898 18:5840160-5840182 GGGTTTAGGGAGGGTGAGACAGG - Intergenic
1154332239 18:13439716-13439738 GGGTGCAGGAAGAGGGAGGAAGG + Intronic
1154356441 18:13625747-13625769 GGGTGGTGGCAGGGGGAGGAGGG - Intronic
1154356450 18:13625767-13625789 GGGTGCTGGCGGGGGGAGGAGGG - Intronic
1155044588 18:22092987-22093009 GGGTGGTGGGAGGGTGCGAAGGG - Intronic
1155100828 18:22608167-22608189 GGCTGGAGGCTGGATGAGAAAGG + Intergenic
1156245574 18:35294630-35294652 GGGTGGAGGAAGAGTGAGAATGG - Intergenic
1156349831 18:36294753-36294775 GGATGCATGCAGGTTGAGGACGG + Intergenic
1156924249 18:42557174-42557196 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
1157496618 18:48161545-48161567 TGGGGCCGGCAGGGAGAGAAAGG - Intronic
1158192286 18:54844009-54844031 GGCTGCAGGGAGGAGGAGAAGGG + Intronic
1158476504 18:57784520-57784542 GGGTGCAGTCTGGAAGAGAAAGG + Intronic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1158584444 18:58718950-58718972 GGGTGAAGACATGGTAAGAATGG + Intronic
1158963844 18:62607091-62607113 GGGTGCCGTCAGGGTGGGAAGGG + Intergenic
1159268069 18:66110872-66110894 GGATGGAGGGAGGGGGAGAATGG - Intergenic
1159826919 18:73224288-73224310 GTGTGCAGGCAGGGAGTGATGGG + Intronic
1160517442 18:79486465-79486487 TGGTGTAGGCAGCGGGAGAAAGG - Exonic
1160566790 18:79790921-79790943 GGGGGCAGGGAGGGAGAGAGAGG - Intergenic
1160700099 19:501946-501968 GGGGGCAGGGAGGGTGGGAAGGG + Intronic
1160840452 19:1144387-1144409 GGCTGTAGGCAGGGTGGGCAGGG + Intronic
1161021838 19:2014625-2014647 GGGTGCAGGCGGGGGGTGGAGGG + Intronic
1161836974 19:6654421-6654443 GGGTGGGGGTAGGGTGAGGACGG + Intergenic
1161849275 19:6730512-6730534 GGGTGCAGCCTGGGTGAGTCTGG - Intronic
1162057178 19:8071687-8071709 GGGTGCAGGCAGGGTTGGAGGGG + Intronic
1162156123 19:8679115-8679137 GGGGGCAGCCAGGGAGAGAGAGG - Intergenic
1162968651 19:14167480-14167502 GGCAGCAGGCAGGGTGGGAAGGG - Intronic
1163644933 19:18483838-18483860 AGGTGCAGGCAGGGTGGGCAGGG - Intronic
1163685442 19:18709493-18709515 GGGAGCGGGCAGGTTAAGAAGGG + Intronic
1163764171 19:19153194-19153216 GGGGACAGACAGAGTGAGAAGGG - Intronic
1163779966 19:19240937-19240959 GGGACCAGGCAGAGTGAGTAGGG - Intronic
1164523629 19:28997735-28997757 GGGTGCAGGCTAGTGGAGAATGG + Intergenic
1164852292 19:31494177-31494199 GGGTGGAGGATGGGTCAGAAAGG - Intergenic
1164941200 19:32253260-32253282 GGGTGCAGGCCTGGTGACCAGGG - Intergenic
1164941855 19:32256956-32256978 GGGGGCAGGCAGGTGGTGAAGGG + Intergenic
1165249052 19:34515088-34515110 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
1165560136 19:36671974-36671996 GAGTGCAGGCTGGGAGAGAAAGG - Intergenic
1165737029 19:38183361-38183383 GGGGGCGGAGAGGGTGAGAAGGG + Intronic
1166348166 19:42179521-42179543 GGGGGAAGGCAGGGAGGGAAAGG + Intronic
1166359483 19:42247135-42247157 GGGTGTGGGCAGGGTGCGAGGGG + Intronic
1166850368 19:45757237-45757259 GGGTCCAGGCAGGGAGCCAAGGG - Exonic
1167158162 19:47751616-47751638 GGGTGATGGGAGGGTGAGGAGGG + Intronic
1167549233 19:50148108-50148130 GGGTGCAGGCCGGGCCAGACAGG - Intergenic
1167642245 19:50688224-50688246 GGGGCCAGGGAGGGTGGGAAAGG - Intronic
1167777146 19:51565709-51565731 GGGAGGAGGCAGGATGAGGAAGG - Intergenic
1167964750 19:53134053-53134075 GGGTTTAGGCAGTGTGAAAATGG + Intronic
924998141 2:382736-382758 GGGCTCAGGCTGGGTGAGATGGG - Intergenic
925057023 2:863904-863926 GGGGGCAGGAAGGGTGAGGCTGG - Intergenic
925057059 2:864026-864048 GGGGGCAGGGAGGGTGAGGCTGG - Intergenic
925057079 2:864087-864109 GGGGGCAGGGAGGGTGAGGCTGG - Intergenic
925153940 2:1636036-1636058 GGGGGCAGACAGGGTGACAGTGG + Intronic
925390921 2:3493334-3493356 GGGGACAGGCAGGGAAAGAAAGG + Intergenic
925844915 2:8026466-8026488 CTCTGCATGCAGGGTGAGAATGG + Intergenic
925886895 2:8401234-8401256 GGGTGCAGGCAGAAGGGGAAAGG + Intergenic
925894963 2:8464031-8464053 GGGTGCAGCCAGGCTGAGGCGGG - Intergenic
926043052 2:9690235-9690257 GTGGGGAGGCAGTGTGAGAAGGG + Intergenic
926682427 2:15674104-15674126 GGGAGCAGGCAGGGTGAGGCTGG + Intergenic
926780416 2:16466055-16466077 GGGTGAAAGCAAGTTGAGAAAGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926878906 2:17518606-17518628 GGGTGGGGGCAGGGAGAGGAGGG - Intergenic
926881335 2:17547876-17547898 GAGTGCAGGTTGGGGGAGAAGGG - Intronic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
929742809 2:44621629-44621651 TGTAGCAGGAAGGGTGAGAATGG + Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
930044224 2:47155033-47155055 GCGTGAGGGCAGGGAGAGAAGGG + Intronic
930137611 2:47918075-47918097 GGCTGGAGTCAGGGGGAGAAGGG - Intergenic
930614231 2:53577024-53577046 GGTCGCAGGCAGGTTGTGAAAGG + Intronic
930723437 2:54659498-54659520 GTGTGCACACAGGATGAGAAAGG - Intronic
931223253 2:60307312-60307334 GGGGGCAGGCTGGGTGTGAAGGG - Intergenic
932446143 2:71782710-71782732 GGGTGCAGTCTGCGTGGGAAGGG + Intergenic
933623267 2:84569391-84569413 TGGTGTAGGAAGGGTGAGGATGG + Intronic
933887674 2:86734900-86734922 GGGAGGAGACAGGGTGGGAATGG - Intronic
933897346 2:86823932-86823954 GGGTCCAGGCAGAGAGAGGAGGG + Intronic
933922503 2:87061812-87061834 GGGAGGAGACAGGGTGGGAATGG + Intergenic
934474914 2:94587418-94587440 GGCTCCAGGCAGGGTGGGGATGG + Intergenic
934564650 2:95331582-95331604 GGGCGCAGGCAGCGGGAGCAAGG - Intronic
934571629 2:95376318-95376340 GGGAGCAGGCGGGGTGCGAGTGG + Intronic
934579217 2:95425150-95425172 AGATGCAGGCAGGCTGGGAATGG - Intergenic
934600229 2:95651574-95651596 AGATGCAGGCAGGCTGGGAATGG + Intergenic
936049248 2:109210725-109210747 GGGTGTAGGCAGGGAGGAAAGGG + Intronic
936173486 2:110197483-110197505 CACTGCAGGCAGGGTGAGCAGGG + Intronic
936533582 2:113293575-113293597 AGATGCAGGCAGGCTGGGAATGG + Intergenic
937076671 2:119112408-119112430 GGGTGGAGCCAGGGTCTGAATGG - Intergenic
937863609 2:126731979-126732001 GGTGGCAGGGAGGGTGACAATGG - Intergenic
939454592 2:142418002-142418024 GGGAGGAGGGAGGGGGAGAAGGG - Intergenic
940071454 2:149692680-149692702 GGGTGCTGGCATGGTGGGCAGGG + Intergenic
940199652 2:151136506-151136528 GGGTGCTGGTCAGGTGAGAATGG - Intergenic
940864519 2:158804597-158804619 GGATGCAGACAGGAGGAGAATGG - Intronic
942678329 2:178451173-178451195 GGGGGCAGGCAGGGTGGGGGCGG + Exonic
942752846 2:179307566-179307588 GGGTGTAGACAGGGAGAGAAAGG - Intergenic
943061390 2:183044972-183044994 GGGTAGAGGCACGGAGAGAAGGG - Intergenic
944539964 2:200745529-200745551 GGGTCATGGCAGGGTGAGAATGG - Intergenic
946058055 2:216918526-216918548 GGGTGCATGCAAGGAGAGGAGGG - Intergenic
946140066 2:217682634-217682656 GGGTGGAGGAAGGGTTAGCAGGG - Intronic
946192665 2:218015745-218015767 GGGTGGGGGCAGGGTGGGATAGG + Intergenic
947139148 2:227004857-227004879 GTGGGGAGGCAGGGAGAGAAGGG + Exonic
947565443 2:231190391-231190413 GAGTTCAGGCAGGGAGGGAAAGG + Intergenic
948698825 2:239748019-239748041 AGGGGCAGGCAGGCTGAGTATGG - Intergenic
1168799118 20:633404-633426 GGGAGAAGCCAGGCTGAGAACGG - Intergenic
1172036581 20:32015070-32015092 AGGTGCGTGCAGGATGAGAAGGG + Exonic
1172043972 20:32066154-32066176 GGGTGAAGGTGGGGAGAGAATGG - Intronic
1172195256 20:33087103-33087125 GGGTCCAGGCAAGGAGAGGAGGG + Intronic
1172776178 20:37408338-37408360 GGGTGCATGCAGGGTGTGTGTGG + Intergenic
1173063240 20:39681945-39681967 GGGTGCAGTCAGCGAGAGATGGG - Intergenic
1173671303 20:44800920-44800942 GGGTGGAGGAAGGGTGGGATGGG - Intronic
1173825222 20:46043810-46043832 TGGTGCAGGAAGGGTGGGGAGGG + Intronic
1173859707 20:46275188-46275210 GGGAGCGGACAGGGTGAGAGGGG - Intronic
1174264604 20:49322289-49322311 GTGTGGAGGCAGGGAGAGAGTGG + Intergenic
1175372222 20:58499695-58499717 GGGTGGAAGCAGGGTGTGAAGGG - Intronic
1175676400 20:60949871-60949893 GGGGGAAGGGAGGGGGAGAAAGG + Intergenic
1176115713 20:63431073-63431095 GGGGGGAGGCAGGACGAGAAGGG + Intronic
1176182075 20:63754331-63754353 AGGCGCTGTCAGGGTGAGAAGGG - Intronic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177267324 21:18801537-18801559 GGTTCCAGGCAGAGTAAGAATGG + Intergenic
1179146741 21:38774755-38774777 TGGTACAGGCAGGGGGAGGATGG + Intergenic
1179720852 21:43315407-43315429 GGCTGCAGCCTGGGTGAGCAGGG + Intergenic
1180123224 21:45767897-45767919 AGGGGCAGGCAGTGTGAGCAAGG + Intronic
1180184302 21:46131850-46131872 GGTTGCAGGCAGGGTGCGAATGG + Intronic
1180198333 21:46210442-46210464 GGCTGGAGGCTGTGTGAGAAGGG - Intronic
1180794432 22:18595128-18595150 GGGAGAAGGGAGGGAGAGAATGG + Intergenic
1180821395 22:18831123-18831145 GGATGCAGGCAGGATGATCACGG + Intergenic
1181191583 22:21144922-21144944 GGATGCAGGCAGGATGATCACGG - Intergenic
1181207614 22:21265588-21265610 GGATGCAGGCAGGATGATCACGG + Intergenic
1181227307 22:21400192-21400214 GGGAGAAGGGAGGGAGAGAATGG - Intergenic
1181251343 22:21534647-21534669 GGGAGAAGGGAGGGAGAGAATGG + Intergenic
1181523735 22:23466304-23466326 AGGTGGTGGCTGGGTGAGAAGGG + Intergenic
1181661771 22:24355798-24355820 GGGGGGAGGGAGGGAGAGAAGGG - Intronic
1181696215 22:24594057-24594079 GGCGGCAGGCAGAGTGAGATGGG + Intronic
1182047206 22:27284744-27284766 TGGTGCAGGGCTGGTGAGAAGGG - Intergenic
1183343377 22:37294215-37294237 GGGTGCAGGCAGGGTGGAGGTGG + Intronic
1183349154 22:37325038-37325060 GGCGGCAGGGAGGGTGGGAAGGG - Intergenic
1183633863 22:39049259-39049281 GGATGCTGGCAGGGGCAGAAGGG - Intronic
1183659335 22:39209436-39209458 GTGTGCAGGGAGGGTGACAGTGG - Intergenic
1183890390 22:40922976-40922998 TGGTGCCGACAGGGTGAAAAAGG + Intronic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184249820 22:43253709-43253731 TGGTGCAGGCGGGGGGAGGAGGG - Intronic
1184787248 22:46677871-46677893 GGGAACAGAGAGGGTGAGAAGGG + Exonic
1203219305 22_KI270731v1_random:29828-29850 GGATGCAGGCAGGATGATCACGG - Intergenic
1203271520 22_KI270734v1_random:56999-57021 GGATGCAGGCAGGATGATCACGG + Intergenic
949254540 3:2030159-2030181 GGATGGAGGCAGGGAGTGAAAGG + Intergenic
950263903 3:11561082-11561104 GGGTGCAGCCAGGCTCAGGAAGG - Intronic
950530487 3:13549794-13549816 GGGAGCTGGCGGGGTGAGCATGG - Intronic
950872370 3:16240856-16240878 GGGTGGAGGCAGGGTCAGGGAGG - Intergenic
951017096 3:17742933-17742955 GGTTGGAAGCAGGGAGAGAAGGG - Intronic
951896146 3:27611657-27611679 GGCAGCAGGCAGGGAGAGAACGG + Intergenic
952210842 3:31227746-31227768 GGGTTCAGGCATGGTGTGGATGG + Intergenic
952497677 3:33929970-33929992 GGATGCTGGCAGGGTGGGATGGG + Intergenic
952968607 3:38636774-38636796 CGGTGCTGCCAGGGTGAGGAGGG + Intronic
953269003 3:41421309-41421331 GGGTGCAGGCAGTATGATACAGG - Intronic
953404194 3:42652557-42652579 GGCTGGAGGTTGGGTGAGAAGGG - Intergenic
953489420 3:43336254-43336276 GGGTGGAGGGAGGGTAAGGAGGG - Intronic
953821335 3:46209883-46209905 GGGTGCATCGAGGGTGGGAAGGG + Intronic
953867823 3:46599519-46599541 GGGAGCGGGCAGGGGGAGAATGG - Intronic
954945978 3:54424739-54424761 GGGAGGATGCAGGGAGAGAATGG - Intronic
955320388 3:57970158-57970180 GCTTCCAGGCAGGGTAAGAATGG + Intergenic
956171391 3:66436326-66436348 GGGTGCAGGCAAGCTCAGGAAGG + Intronic
956717795 3:72093641-72093663 GGGTCAGGGCAGGGTGAAAAGGG - Intergenic
957905047 3:86543089-86543111 GGGTGGAGACACGGAGAGAAGGG + Intergenic
958058711 3:88449071-88449093 GGAGGCAGGGAGGGAGAGAAGGG - Intergenic
959580442 3:107977691-107977713 GAGGTCAGGCAGGGTGAGAGAGG + Intergenic
960096306 3:113693558-113693580 GGTTGCAGGAAGAGTCAGAAGGG + Intronic
960337666 3:116437650-116437672 GGGAGGAGGAAGGGAGAGAAGGG + Intronic
960386109 3:117023765-117023787 GGGGGAAGGAAGGGAGAGAAGGG - Intronic
960711881 3:120538386-120538408 GAGGGCAGGCAGGGTGGGAAGGG - Intergenic
961383081 3:126508527-126508549 AGTTGCAGACAGGGAGAGAAAGG + Intronic
961632246 3:128309645-128309667 GGGTGAAAGCAAGCTGAGAAAGG + Intronic
961653561 3:128429320-128429342 CGGTGGAGGCAGGGTGAGCGGGG + Intergenic
962086937 3:132201156-132201178 GAGTGCAGCAAGGGTCAGAAGGG + Intronic
962417491 3:135196414-135196436 AGGAGCAGGCATGGTAAGAAAGG + Intronic
962582018 3:136806623-136806645 GGGTGCAGAAAGGGTAAAAAGGG + Intergenic
962731899 3:138291294-138291316 GGGTGCAGAGAAGATGAGAAAGG - Intronic
962754457 3:138457364-138457386 AGGGGCAGGAAGGGAGAGAAAGG + Intronic
963058372 3:141205803-141205825 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
963078124 3:141367072-141367094 GAGTGCAGGAGGAGTGAGAAGGG - Intronic
964125712 3:153231597-153231619 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
964213837 3:154257121-154257143 GGGTGCAGGCTGTGTGAGCCAGG - Exonic
964588810 3:158337719-158337741 AGGTGCAGCCAGGATGAGATAGG - Intronic
964941250 3:162159108-162159130 GGGTGGAGACATGGAGAGAAGGG + Intergenic
965119293 3:164530469-164530491 GAGTCCAAGGAGGGTGAGAAAGG - Intergenic
965299625 3:166993671-166993693 GGCTGCAGGGAGTGTGATAATGG + Intergenic
965719687 3:171647874-171647896 GGGTGCAGGCAGGGAAAAACAGG - Intronic
966882616 3:184358816-184358838 GGGTGCAGGGAAGGGAAGAAGGG + Intronic
966886233 3:184379559-184379581 GGGCCCAGGCAGGGGGAGATCGG + Intronic
966931224 3:184677093-184677115 GGCTGCATGCAGGCAGAGAAAGG + Intronic
967212392 3:187180307-187180329 GGGTGGAGACAAGGAGAGAAGGG + Intronic
967243286 3:187462532-187462554 GGGTGCAGGCAGAATTACAAGGG - Intergenic
967244392 3:187471087-187471109 GGGTACAGACATGGAGAGAAGGG + Intergenic
967834057 3:193945920-193945942 GGGTGCCTGCAGGGAGAGAAGGG + Intergenic
967900026 3:194440388-194440410 ATGTGCAAGCATGGTGAGAATGG + Intronic
967976950 3:195040839-195040861 AGGTGCAGGCCGGGTGACACAGG - Intergenic
968329655 3:197856125-197856147 GGGTACATGCAGGGAGGGAAAGG - Intronic
968631578 4:1654763-1654785 GGGAGCAGGCGGGGTGAGCTGGG + Intronic
968637979 4:1692212-1692234 GGGTGAAGGCAGTGGGAGCAGGG + Intergenic
968837226 4:2973908-2973930 GTGTGGAGGCAGAGTGAGAGAGG - Intronic
969241290 4:5899959-5899981 GAGTCCAGGCAGGGTAAGAGGGG - Intronic
969262471 4:6042870-6042892 GGGCGCAGGCACGGAGAGTACGG + Intronic
969281565 4:6174395-6174417 GGGTCCAGGCACAGCGAGAAAGG + Intronic
969367215 4:6703461-6703483 GAGCCCAGGCAGGGTGAGGAGGG - Intergenic
969397856 4:6934322-6934344 GGGTGCCGGCCCGGTGAGCATGG + Intronic
969629762 4:8329330-8329352 GGGTGTAGGGAGGGTGCGATGGG + Intergenic
970142940 4:13002516-13002538 GGGGGCAGGGAGGGAGAAAAGGG - Intergenic
970496124 4:16627983-16628005 CCGTGCAGGCATGGTGAAAAGGG - Intronic
970854270 4:20635051-20635073 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
971405617 4:26319463-26319485 GGGCGCGGGCGGGGTGGGAAGGG - Intronic
971834815 4:31749267-31749289 GGGAGGAGGGAGGGAGAGAAGGG - Intergenic
972270102 4:37502637-37502659 GGGTGCTAGCAGGGCAAGAAAGG + Intronic
972866530 4:43240049-43240071 AGCTGCAGGCAGGGTGCTAATGG + Intergenic
975984982 4:80194080-80194102 GGGTGGAGAAAGGGTAAGAAAGG - Intronic
976062522 4:81145514-81145536 TGATCCAGGAAGGGTGAGAAAGG - Intronic
976359536 4:84161353-84161375 AGGTGCTGGCAGGGTGGAAAAGG - Intergenic
977041780 4:92026735-92026757 GGGTACAGACAAGGAGAGAAGGG - Intergenic
977041796 4:92026796-92026818 GGGTACAGACAAGGAGAGAAGGG - Intergenic
977225587 4:94388346-94388368 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
977874015 4:102128281-102128303 GGGAGCAGGCATAGTGAGAATGG - Intergenic
978173586 4:105703591-105703613 GGGTGCAGGCAGAGAGAGAATGG - Intronic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
978833270 4:113115410-113115432 GGGTAGAGGAAGGGAGAGAAGGG - Intronic
980148163 4:129015078-129015100 GAGTGCTGGCAGGGTGGGACTGG + Intronic
981038109 4:140193163-140193185 GAGTGAGGGCAAGGTGAGAATGG + Intergenic
983938777 4:173521422-173521444 TGGTGAAGGTAGGGTGAAAACGG + Intergenic
984165545 4:176299485-176299507 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
984321955 4:178208027-178208049 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
984860122 4:184230437-184230459 GGGGGCTGGCAGGGAGAGAGGGG - Intergenic
985673044 5:1216165-1216187 GGGTGGAGGCTGGGGGAGAATGG + Intronic
985897845 5:2759865-2759887 GGCTGCAGGCAGAGAGACAAGGG - Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986781627 5:11071692-11071714 GAGTGCAGACTGGGTAAGAAGGG + Intronic
986970743 5:13333167-13333189 ATGAGCAGGCAAGGTGAGAAAGG + Intergenic
987079799 5:14416739-14416761 GGGTGGGGGAAGGGTGGGAAGGG - Intronic
987294362 5:16537041-16537063 GGAGGCAGGCAGGGTGGGATTGG - Intronic
987518864 5:18952611-18952633 GGGTGAAGGCAAGGGGTGAAGGG + Intergenic
988169166 5:27632565-27632587 TGGTGCAGGCTGGGGGAGAGAGG + Intergenic
989113477 5:37929571-37929593 GAGTGTGGGCAGGGTGGGAAAGG + Intergenic
989245561 5:39250258-39250280 GAGGGCAGGCAGAGTGAGAGAGG + Intronic
991958781 5:72021298-72021320 TTGGGCAGGCAGAGTGAGAAGGG + Intergenic
992058844 5:73021335-73021357 GGAAGGAGGGAGGGTGAGAAAGG + Intronic
992143337 5:73820797-73820819 AGGTGCCTGCATGGTGAGAATGG - Intronic
992205227 5:74424224-74424246 GGGTGCAGGCATGCTGAGAATGG - Intergenic
992645449 5:78807395-78807417 GGGTACAGGCACAGTGAAAATGG + Intronic
993410661 5:87569199-87569221 GGGTGCTGGAAGGGCCAGAATGG - Intergenic
994375955 5:99015883-99015905 GGGTGGAGACATGGGGAGAAGGG + Intergenic
994375975 5:99015941-99015963 GGGTGGAGACACGGAGAGAAGGG + Intergenic
994720077 5:103370072-103370094 GGGAGCAGGAAGGGAGGGAATGG + Intergenic
994994244 5:107039260-107039282 GGGTGAAGGGAAGGTGAGAGTGG + Intergenic
995125477 5:108573752-108573774 GGGTACAGACATGGAGAGAAGGG + Intergenic
995782394 5:115791975-115791997 GGGTGAAGACAGGGTGAAAGAGG + Intergenic
997282926 5:132659845-132659867 GGGTGCAGGGTGGGTGTGAGAGG - Intronic
997391830 5:133523409-133523431 GGGTGCAGAGTGGGAGAGAAAGG + Intronic
997870747 5:137503285-137503307 GGTTGCAGGGAGGGTGGGGATGG - Intronic
998378571 5:141708026-141708048 GGGTGGGGGCAGGGTGAGGTGGG + Intergenic
1000137136 5:158363749-158363771 GGGGGCAGACAGGTTGTGAATGG + Intergenic
1000350874 5:160351679-160351701 GGGTGAGGGAAGGATGAGAAGGG + Intronic
1000439479 5:161249315-161249337 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
1001227039 5:169953736-169953758 AAGTGCTGGCAGGTTGAGAAGGG - Intronic
1001288101 5:170438215-170438237 GGGTCCAGGCTGAGGGAGAAGGG - Intronic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1001976639 5:176005774-176005796 GGCTGCATGCAGGGAGAGACAGG - Intronic
1002240787 5:177837998-177838020 GGCTGCATGCAGGGAGAGACAGG + Intergenic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1002522093 5:179797785-179797807 TGGGGCAGGCCGGGTGCGAACGG + Exonic
1002660869 5:180790491-180790513 GGTGGCAGGCAGGGAAAGAAAGG - Intergenic
1002813535 6:657153-657175 GGCTGGAGGGAAGGTGAGAACGG - Intronic
1002941378 6:1719322-1719344 GAAGGCATGCAGGGTGAGAAAGG + Intronic
1003035265 6:2636105-2636127 GGCCACAGGCAGGGAGAGAAAGG + Intergenic
1003412236 6:5875964-5875986 GAGAGCAGGGAGGGTGAGACAGG + Intergenic
1003975991 6:11345108-11345130 GGGGTGAGGCAGGATGAGAAGGG + Intronic
1004031128 6:11870574-11870596 AGGTGAAGGCAGGGTGGGGACGG - Intergenic
1004604187 6:17178400-17178422 GGAGGCAGGCTGGGAGAGAATGG - Intergenic
1004772064 6:18795449-18795471 GTGTGGGGGCAGGGTGAGGAAGG - Intergenic
1005015231 6:21369217-21369239 GAGTTGAGGCAGGCTGAGAAGGG - Intergenic
1005016211 6:21377695-21377717 GGATACACGCAGGGTAAGAATGG + Intergenic
1005139728 6:22614867-22614889 GCCTGGAGGCAGAGTGAGAAAGG + Intergenic
1005801515 6:29429786-29429808 GGGGGAAGACAGGGAGAGAAAGG + Intronic
1005954791 6:30656349-30656371 GGGTGGAGGCAGGATGATAGGGG - Intronic
1006048361 6:31318953-31318975 GGGTGCAGTGAGTGAGAGAAGGG + Intronic
1006268869 6:32948952-32948974 TGGTGCAGGCAGGGCGAGCAAGG - Intronic
1006297573 6:33176799-33176821 GGGTGCAGAGAGGGTGACAGGGG - Intronic
1006375687 6:33670584-33670606 GGGTGGAGGCAGGGTGGGCGGGG + Intronic
1006618633 6:35346789-35346811 AGGCGCAGGCAAGGTAAGAAGGG - Intronic
1006699408 6:35959672-35959694 GGGAGTGGGCAGGTTGAGAAAGG + Intronic
1006738675 6:36292574-36292596 GGGTGCAGGCAGGGTGGGAGGGG - Intronic
1006820520 6:36890297-36890319 GGCTGCAGGCAGGGGGAAACAGG - Intronic
1007496425 6:42263090-42263112 GGGAGCAGGCAGTGTGAACAAGG + Intronic
1007530906 6:42541371-42541393 ATCTGCAGGCAGGGTGACAAGGG - Intergenic
1007606080 6:43119153-43119175 GGGTGCAGGCAGGGTGTAAAGGG + Intronic
1007733441 6:43965719-43965741 GGGTGAAGGCTGGATGAGGAGGG - Intergenic
1007762861 6:44143780-44143802 GGAAGCAGGCAGGGTAAGAGGGG + Intronic
1007957222 6:45929124-45929146 TGGGGCAGGCATGGGGAGAAGGG - Intronic
1008078107 6:47167143-47167165 GGGTGCAAGGATGGGGAGAAGGG - Intergenic
1009265367 6:61547749-61547771 AAGTGCAGTCAGGGTGAGATCGG + Intergenic
1011351311 6:86426772-86426794 GAGTACAGGCTGGGTAAGAAAGG + Intergenic
1012394987 6:98785992-98786014 GGGTAAAGGAAGGGAGAGAAGGG - Intergenic
1012637941 6:101570479-101570501 GGGAGCTGGCAGGGGGAGAAGGG - Intronic
1012869779 6:104659201-104659223 AGGTGCAGGCAGGTGGAGAAGGG + Intergenic
1013418438 6:109945303-109945325 TGGTGCAAGCATGGAGAGAAAGG - Intergenic
1013605826 6:111746822-111746844 GGAGGGAGGCAGGGAGAGAAAGG + Intronic
1013987065 6:116207622-116207644 GGAAGCAGGCAGTGTGAAAAAGG + Intronic
1014386011 6:120803484-120803506 GGGAGCAGGCACAGTAAGAAAGG - Intergenic
1015277948 6:131403851-131403873 GGGTGGAGACATGGAGAGAAGGG - Intergenic
1015333037 6:132003727-132003749 GGGCGCAGCAAGGGTGGGAAGGG - Intergenic
1016204314 6:141453716-141453738 GGGTGGAGACATGGAGAGAAGGG - Intergenic
1016223828 6:141709107-141709129 GGGTGGTGGCAGGGCGAGACGGG - Intergenic
1016942354 6:149493378-149493400 GGGTGTAAGCAGGATCAGAATGG - Intergenic
1017693215 6:156988185-156988207 GGGAGCTTGAAGGGTGAGAAGGG + Intronic
1018291285 6:162294260-162294282 GGGTGTAGGAAGGAGGAGAATGG - Intronic
1018565096 6:165143469-165143491 GGGTGCGGGCAGGGTGGCTATGG + Intergenic
1018845444 6:167552229-167552251 GTGTGCATGAAGGCTGAGAAAGG - Intergenic
1018966709 6:168495666-168495688 GGGGGCAGGCAGTGTGGGAGTGG - Intronic
1019039550 6:169092229-169092251 GGATGCAGGGAAGGTGAGAGGGG + Intergenic
1019082772 6:169446350-169446372 GGGTGCAGGGAAGGTGGGCAGGG + Intergenic
1019082789 6:169446394-169446416 GGGTGCAGGGAAGGTGGGCAGGG + Intergenic
1019701299 7:2476093-2476115 GGGGGCAGGCTGGGTGGGCAGGG - Intronic
1019978220 7:4601497-4601519 GGGTGGGGGCAGGGGGAGAGAGG + Intergenic
1019996014 7:4725007-4725029 GGCAGCAGGCAGGGTTAGGAGGG - Intronic
1020076352 7:5261492-5261514 GCGTGCAGGCAACCTGAGAAGGG + Intergenic
1020148382 7:5662783-5662805 GGGGGCAGGCAGTGTGAACAGGG + Intronic
1020213665 7:6172721-6172743 GGGTGCAGGCCTGGTGAGTCTGG - Intronic
1021253609 7:18361925-18361947 GGGAGCTGGCAAGGAGAGAAGGG - Intronic
1021579082 7:22133239-22133261 GGGTGCTGGCCAGGTGAGAGGGG + Intronic
1022196166 7:28069472-28069494 GGGAGCAGGCAGGGAGCTAAAGG - Intronic
1022381573 7:29865551-29865573 GGGTGCAGACAGGGAAGGAAAGG + Intronic
1022426861 7:30277413-30277435 AGGGGCAGGCAGGGTCAGAGTGG - Intergenic
1022523975 7:31025638-31025660 AGCTGCAGGCAGGGTGGAAAGGG + Intergenic
1022843038 7:34182783-34182805 GGGGGTAGGAAGGGTGGGAAGGG - Intergenic
1022849313 7:34243965-34243987 GGGTGCAGGCAGTGGGGGAATGG + Intergenic
1023187720 7:37549119-37549141 GGGAGCAGGAAGGGTGATAAAGG - Intergenic
1023277308 7:38533792-38533814 GGAAGAAGGCAGGCTGAGAAGGG - Intronic
1023518463 7:41027212-41027234 GCGTGGATGCAGGGTGAGGATGG - Intergenic
1023943019 7:44782152-44782174 TGGTGCCGGCAGGCTGAGAGAGG - Intergenic
1024786828 7:52917416-52917438 AGGTGGAGGCAGTGTGACAATGG + Intergenic
1025002037 7:55324429-55324451 GGGTGCGGGTGGGGTGAGAAGGG - Intergenic
1025202738 7:56972081-56972103 GCGTGCAGGCAACCTGAGAAGGG - Intergenic
1025669206 7:63604845-63604867 GCGTGCAGGCAACCTGAGAAGGG + Intergenic
1025829575 7:65038060-65038082 GGGTGGAGCCCGGGGGAGAAAGG - Intergenic
1025916812 7:65873009-65873031 GGGTGGAGCCCGGGGGAGAAAGG - Intergenic
1026360977 7:69600193-69600215 GGGTGCAGGGAGGGGGCGCAGGG - Intronic
1026478940 7:70762609-70762631 GGGTGTGGGAAGGGAGAGAAAGG - Intronic
1028462016 7:91104597-91104619 GGCTGGAGGGAGGGTGAGAGAGG - Intronic
1028530905 7:91837620-91837642 GGGAGCAGGCAAGCTGAGGATGG + Intronic
1029029783 7:97455386-97455408 GGATGCAGCCTGGATGAGAATGG + Intergenic
1029598161 7:101548657-101548679 TGGGGCAGGGAGGGTGGGAAGGG + Intronic
1031941282 7:127792257-127792279 GGGGGCAGGCAGGGTGAAGGTGG + Intronic
1031969798 7:128055807-128055829 GGATGAAGGCATGCTGAGAAAGG - Intronic
1033274215 7:139958923-139958945 GGCTGGAGCCAGGGGGAGAAGGG + Intronic
1033607588 7:142938692-142938714 GGGTGAAGAGAGGGTGTGAATGG + Intergenic
1034415372 7:150961809-150961831 GGGAGCAGGCCAGGTGGGAAGGG + Intronic
1035705373 8:1670613-1670635 GGGTGCGTGCTGGGTGAGGATGG + Intronic
1036442970 8:8797571-8797593 GGATGGGGGCAGGGGGAGAAGGG + Intronic
1036918844 8:12832455-12832477 GAGAGCAGGCAGGGAGAGAGGGG - Intergenic
1037364556 8:18107989-18108011 CGGTGCAGGCTGGGGGAGAGGGG + Intergenic
1037659693 8:20916166-20916188 GGGAGGAGGCAGGGAGAGAATGG - Intergenic
1038443185 8:27585886-27585908 GGGGCCAGGCAGGGTGGGGATGG - Intergenic
1038972041 8:32647043-32647065 GGGTGGAGGCAGGGCGGGGAAGG + Intronic
1039793935 8:40896611-40896633 CGGAGGAGGCAGGGGGAGAAAGG + Intronic
1040491320 8:47924975-47924997 GGGTGCAGGCAGGGTGAGAAGGG - Intronic
1040504470 8:48034921-48034943 GGCTGCAGGGAGGGGGAGCAAGG - Intronic
1042217159 8:66438336-66438358 GGGAGGAGGAAGGGTCAGAATGG + Intronic
1043531588 8:81157043-81157065 GGGAGAAGGCAGGGTGAATAAGG - Intergenic
1043994660 8:86798220-86798242 GGGTGCAGGGAGAGTGGCAATGG - Intergenic
1044148713 8:88746907-88746929 GGGTACAGACATGGAGAGAAGGG + Intergenic
1044319428 8:90785853-90785875 GGAAGGAGGCAGGGAGAGAAAGG + Intronic
1044340888 8:91045054-91045076 GCGGGGAGGCAGGCTGAGAAAGG - Intergenic
1045378525 8:101600070-101600092 GGGGGAAGGCTGGGTGAGAAAGG + Intronic
1046488597 8:114917914-114917936 GGGCTCAGGGAGGGAGAGAAGGG + Intergenic
1046841741 8:118866110-118866132 GGGAGAAGGCAGGGGGAGAATGG + Intergenic
1047725928 8:127683971-127683993 GAGTGCAGGCAGGGATAGAGGGG - Intergenic
1048924155 8:139255876-139255898 GGGTGCAGGGCGGGTGAAAGGGG - Intergenic
1049330191 8:142046288-142046310 GGCTGCAGGGAGGGTGGGAGAGG + Intergenic
1049334601 8:142076513-142076535 GGGGGCAGGCATGGTCAGCAAGG - Intergenic
1049385529 8:142341247-142341269 GGGTGCAGGGAGGCTGGGAAGGG - Intronic
1049607025 8:143534508-143534530 GGGAGCAGGCCAGGTGAGCAGGG + Intronic
1049696123 8:143985116-143985138 GGGTGCAGGGACTGTGACAATGG - Exonic
1049783416 8:144439254-144439276 GGCAGCTGGCAGGGTGTGAAGGG - Intronic
1049785628 8:144449332-144449354 GGGGGCGGCCAGGGTGAGGATGG + Intergenic
1049833110 8:144714431-144714453 GGGTGCAGGAAGGTGGTGAAGGG + Intergenic
1051842475 9:21414053-21414075 GGATGGAGGCAGGGTGGGGATGG + Intronic
1052855140 9:33402342-33402364 GGCTCCAGGCAGGGTGGGGATGG - Intronic
1053010589 9:34630673-34630695 GGCTGGAGGCAGGGAGAGCAGGG - Intergenic
1053683159 9:40498683-40498705 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1053868883 9:42469722-42469744 AGGTGCAGGCTGCGAGAGAAAGG - Intergenic
1053887197 9:42652722-42652744 AAGTGCTGGCAGGTTGAGAAGGG - Intergenic
1053933136 9:43126999-43127021 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054226217 9:62460173-62460195 AAGTGCTGGCAGGTTGAGAAGGG - Intergenic
1054280555 9:63126245-63126267 GGCTCCAGGCAGGGTGGGGATGG + Intergenic
1054296260 9:63334181-63334203 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054394276 9:64638686-64638708 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054428926 9:65143885-65143907 GGCTCCAGGCAGGGTGGGGATGG - Intergenic
1054501454 9:65877650-65877672 GGCTCCAGGCAGGGTGGGGATGG + Intronic
1055445168 9:76375286-76375308 GAGGTCAGGCAGGGTGAGTAGGG - Intergenic
1055733180 9:79300095-79300117 TGGTGCAGGCAGGGTGGGGTGGG - Intergenic
1056258599 9:84825260-84825282 GGGTGGAAGCATGGTGAGAAGGG - Intronic
1056707079 9:88960301-88960323 GGGTGATGGCAGCCTGAGAAAGG + Intergenic
1056707123 9:88960637-88960659 ATGTGAAGCCAGGGTGAGAAGGG - Intergenic
1056824573 9:89867934-89867956 GGGAGCAGGCAGGGTGACCCAGG - Intergenic
1056975997 9:91254370-91254392 GGGTGCAGACAGGATGGGAAGGG + Intronic
1057461404 9:95265941-95265963 GGCTGCAGGCAGCATGAGGAAGG + Intronic
1058897384 9:109412180-109412202 GGGTGCAGGGAGGGAGAGAGAGG - Intronic
1059111134 9:111559372-111559394 GAGTCCAAGTAGGGTGAGAAGGG - Intronic
1059428322 9:114235217-114235239 GGGTGAAGGCAGCGTGTGCAAGG - Intronic
1059447779 9:114349558-114349580 GGCCACCGGCAGGGTGAGAACGG - Intronic
1059589907 9:115647629-115647651 GGGCTCATGAAGGGTGAGAATGG - Intergenic
1059684899 9:116625673-116625695 GGGTGCAGGGGGGTTGAGATGGG - Intronic
1059754902 9:117283554-117283576 GGGTGCAGTGAGGTTAAGAAGGG + Intronic
1060153435 9:121302916-121302938 GAGTGCAGCCAGGATGAGAGCGG + Exonic
1060230007 9:121819301-121819323 GGGAGCAGGCAGTGTCAGCAAGG + Intergenic
1060608620 9:124940830-124940852 GGGTGCTGAAAGGGTGAGAGTGG - Intronic
1061218352 9:129234998-129235020 GGGTGGGGGCAGGGTGGGCAGGG - Intergenic
1061244281 9:129393315-129393337 GGGTCCATGCAGGCAGAGAATGG - Intergenic
1061387858 9:130301052-130301074 GGATGCAGGGAGGGGAAGAAGGG + Intronic
1061435009 9:130555561-130555583 GGGTGCAGGCAGTGTGGGTGAGG - Intergenic
1061574212 9:131496025-131496047 GGGTGCAAGCTGGTTGACAACGG - Exonic
1061680433 9:132240343-132240365 GGGTGGAGGCAGGGAGAGCCAGG - Intronic
1061711878 9:132493568-132493590 GGCTGCAGGTATGGTGTGAAGGG + Intronic
1062034559 9:134377170-134377192 GAGCACAGACAGGGTGAGAATGG - Intronic
1062066148 9:134527390-134527412 GTGTGCAGGAAGGGTGATGAGGG + Intergenic
1062080831 9:134622565-134622587 GGAGGAAGGCAGGGAGAGAAGGG - Intergenic
1062170818 9:135133703-135133725 GGGTGCAGGGAGGGTGACTGGGG + Intergenic
1062181611 9:135194053-135194075 GGGTGCAGGTGGGGTTAGAGAGG + Intergenic
1062245479 9:135563835-135563857 GAGGGCAAGCAGGGTCAGAAAGG - Intronic
1062576850 9:137212791-137212813 GGGAGCAGGCAGGGTGGCAAAGG + Intronic
1185664054 X:1750292-1750314 GGAAGCAAGCAGGGTGAGGATGG + Intergenic
1187291206 X:17955139-17955161 GGGGGCAGACAGGGGGACAAAGG + Intergenic
1190428496 X:50354886-50354908 TGCTGGAGGCAGAGTGAGAAAGG + Intergenic
1192152549 X:68721157-68721179 GGATTCAGGGAGGTTGAGAATGG - Intronic
1194874037 X:99164270-99164292 GGGTAGAGACAGGGAGAGAAGGG + Intergenic
1195807040 X:108785727-108785749 GTGGGAAGGCAGGGTGGGAAAGG - Intergenic
1197470736 X:126864005-126864027 GGGTAGAGACAGGGAGAGAAGGG - Intergenic
1197852626 X:130879433-130879455 GGATGGAGGGAGGGAGAGAAAGG - Intronic
1198723529 X:139651384-139651406 GGTTGCAGGCTGGGTGGGAGGGG - Intronic
1199621232 X:149703513-149703535 GGATGCAGGGAGGGTGAGCCTGG + Intronic
1200119893 X:153785203-153785225 GGCTGCAGGGAGGGTGGGACGGG + Intronic
1200773305 Y:7147320-7147342 GACTGCAGCCAGGGTGACAAAGG - Intergenic
1201156872 Y:11138510-11138532 GGGAGGAGGCAAGGTGAGGAGGG - Intergenic
1201473667 Y:14359023-14359045 GGGTGGAGACAGGGAGAGAAGGG + Intergenic